Báo cáo khoa học: "Analysis of adenoviral attachment to huma

Tài liệu Báo cáo khoa học: Analysis of proteins and peptides on a chromatographic timescale by electron-transfer dissociation MS ppt

... involves capture of the electron into an amide carbonyl group that is hydrogen bonded to the protonated side chain of a basic amino acid. The resulting radical anion abstracts a proton and gen- erates ... C-terminus of the protein, and the presence of PTMs such as methylation (14 Da), dimethylation or formylation (28 Da), trimethylation or acetylation (42 Da), and glutamyl...

Ngày tải lên : 18/02/2014, 16:20

8
578
0

Tài liệu Báo cáo khoa học: Analysis of the molecular dynamics of medaka nuage proteins by ﬂuorescence correlation spectroscopy and ﬂuorescence recovery after photobleaching doc

... 2007 The Authors Journal compilation ª 2007 FEBS 343 Analysis of the molecular dynamics of medaka nuage proteins by ﬂuorescence correlation spectroscopy and ﬂuorescence recovery after photobleaching Issei ... LSM analysis of Olvas–GFP reveals the dynamic nature of the nuage. Schematic diagram of the preparation of PGCs of medaka...

Ngày tải lên : 18/02/2014, 16:20

9
655
0

Tài liệu Báo cáo khoa học: Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant ppt

... FEBS Analysis of oxidative events induced by expanded polyglutamine huntingtin exon 1 that are differentially restored by expression of heat shock proteins or treatment with an antioxidant Wance ... 200 10 1 10 2 FL2-H 10 3 10 4 25Q +NAC 72Q 72Q+NAC 10 3Q 10 3Q+NAC 04080 Counts 12 0 16 0 200 10 0 10 1 10 2 FL2-H 10 3 10...

Ngày tải lên : 19/02/2014, 06:20

18
721
0

Tài liệu Báo cáo khoa học: "ANALYSIS OF OONOUNCTIONS IN PAKSER" potx

... structure fol- lowing it 3) The conj~tion is inserted in the node the first I~ that is found going up in the hierarchy (in fig.2.c, starting from C~NN2 and going u~s, we find 1:m.'.1 ... 1983)) this book-keeping need not be completely explicit, but the interpreter of the language (usually a dialect of PROLOG) has to keep track of the binding of the variables, of...

Ngày tải lên : 21/02/2014, 20:20

8
517
0

Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx

... K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous- pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc Natl Acad Sci USA 98, 5538–5543. 20 Kagawa W, ... ssDNA (5Â-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3Â) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular ssDNA (New England BioLabs, MA, USA) we...

Ngày tải lên : 06/03/2014, 09:22

13
446
0

Báo cáo khoa học: Analysis of Lsm1p and Lsm8p domains in the cellular localization of Lsm complexes in budding yeast ppt

... Analysis of Lsm1 p and Lsm8 p domains in the cellular localization of Lsm complexes in budding yeast Martin A. M. Reijns*, Tatsiana Auchynnikava and Jean D. Beggs Wellcome ... signals The N- and C-terminal extensions of Lsm1 p and Lsm8 p were fused to the N- or C-terminus of GFP, respectively, in order to test whether they contain A B Fi...

Ngày tải lên : 07/03/2014, 02:20

16
515
0

Báo cáo khoa học: Analysis of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family pot

... of the NADH-dependent retinaldehyde reductase activity of amphioxus retinol dehydrogenase enzymes enhances our understanding of the evolution of the retinol dehydrogenase family Diana Dalfo ´ , ... whereas the activity of amphioxus RDH1 was comparable to those of these enzymes. In contrast, the amphioxus enzymes showed lower retina...

Ngày tải lên : 07/03/2014, 09:20

14
477
0

Báo cáo khoa học: "Analysis of Unknown Words through Morphological Decomposition" potx

... Analysis of Unknown Words through Morphological Decomposition Alan W Black Dept of Artificial Intelligence, University of Edinburgh 80 South Bridge, Edinburgh ... method of analysing words through morphological decomposition when the lexicon is incomplete. The method is used within a text-to-speech system to help gen- erate pronunciations of unknown words....

Ngày tải lên : 09/03/2014, 01:20

6
413
0

Báo cáo khoa học: Analysis of the regulatory motifs in eukaryotic initiation factor 4E-binding protein 1 pot

... 2008) doi :10 .11 11/ j .17 42-4658.2008.06372.x Mammalian target of rapamycin complex 1 (mTORC1) phosphorylates proteins such as eukaryotic initiation factor 4E-binding protein 1 (4E-BP1) and the S6 kinases. ... by mTORC1 [4,5,7 ,18 ,19 ]. The ﬁrst proteins shown to contain functional TOS motifs were the ribosomal protein S6 kinases (S6Ks) and the eukaryotic in...

Ngày tải lên : 16/03/2014, 06:20

15
337
0

Báo cáo khoa học: Analysis of the transcarbamoylation-dehydration reaction catalyzed by the hydrogenase maturation proteins HypF and HypE pot

... formation of the HypE- thiocyanate involves ﬁrst the carbamoylation of the C -terminal c ysteine of HypE b y interaction with HypF, then the release of HypF and the subsequent dehydration of the protein ... future whether they can transfer the carboxamido moiety to the HypC · HypD complex. Analysis of the transcarbamoylation reaction catalyzed by...

Ngày tải lên : 16/03/2014, 18:20

9
538
0

Báo cáo khoa học: "Analysis of Selective Strategies to Build a Dependency-Analyzed Corpus" pptx

... Makoto Nagao. 199 4a. KN Parser: Japanese dependency/case structure ana- lyzer. In Proceedings of Workshop on Sharable Nat- ural Language Resources, pages 48–55. Sadao Kurohashi and Makoto Nagao. ... using several fundamental selective strategies for a dependency- analyzed corpus, it is necessary to provide a func- tion to build a selective sampling framework to construc...

Ngày tải lên : 17/03/2014, 04:20

8
488
0

Báo cáo khoa học: "Analysis of Mixed Natural and Symbolic Language Input in Mathematical Dialogs" pdf

... syntactic and semantic analysis. We propose an approach to input understanding in this setting. Our goal is a uniform analysis of inputs of different degree of verbalization: ranging from symbolic ... include: (i) tight interleaving of natural and symbolic language, (ii) varying degree of natural language verbalization of the formal mathematical 1 This work...

Ngày tải lên : 17/03/2014, 06:20

8
402
0

báo cáo khoa học: " Analysis of anther transcriptomes to identify genes contributing to meiosis and male gametophyte development in rice" pptx

... RESEARCH ARTICLE Open Access Analysis of anther transcriptomes to identify genes contributing to meiosis and male gametophyte development in rice Priyanka Deveshwar 1 , William D ... comprehensive analysis of rice anther transcriptomes at four distinct stages, focusing on identifying regulatory components that contribute to male meiosis and germli...

Ngày tải lên : 11/08/2014, 11:20

20
344
0

báo cáo khoa học:" Analysis of proliferative activity in oral gingival epithelium in immunosuppressive medication induced gingival overgrowth" pptx

... Access Research Analysis of proliferative activity in oral gingival epithelium in immunosuppressive medication induced gingival overgrowth Şule Bulut* 1 , Hilal Uslu 2 , B Handan Özdemir 3 and Ömer Engin ... that the increased epithelial thickness observed in Cyclosporin A -induced gingival overgrowth is associated with increased proliferative activity in...

Ngày tải lên : 11/08/2014, 23:22

6
216
0

Báo cáo khoa học: "Analysis of adenoviral attachment to human platelets Nilly Shimony1, Gregory Elkin1, Dror Kolodkin-Gal2, Lina " pptx

... http://www.virologyj.com/content/6/1/25 Page 3 of 13 (page number not for citation purposes) Flow cytometry to detect Ad attachment to nucleated human cellsFigure 1 Flow cytometry to detect Ad attachment to nucleated human cells. ... spherical surface areas of platelets and Ad, given respective diameters of ~3 m and ~150 nm. Fourth, Ad attachment to human platel...

Ngày tải lên : 12/08/2014, 04:21

13
142
0