... versa – mutual effects in fusion proteins containing an intrinsically disordered and a globular protein Ilaria Sambi 1 , Pietro Gatti-Lafranconi 1 *, Sonia Longhi 2 and Marina Lotti 1 1 Dipartimento ... with a forward primer (5Â-TAC CTGGCCAATGAATATGCATCATCATCATCATCATA CTCCGTCGACCCCACC-3Â) designed to introduce a hexahistidine tag and a ClaI restrictio...
Ngày tải lên: 18/02/2014, 04:20
... details about the role of different resi- dues of the aglycone-binding site in the stabilization of ES à and the interdependence between the binding of aglycone and the positioning of glycone in ... (dimboa-Glc) was included to facilitate the visualization of the active site. (C) Agly- cone-binding site of SbDhr1, including the substrate dhur...
Ngày tải lên: 18/02/2014, 17:20
Tài liệu Báo cáo khoa học: Caveolin-1 influences P2X7 receptor expression and localization in mouse lung alveolar epithelial cells docx
... of Caveolin-1 and P2X 7 distribution in control and in Caveolin-1 shRNA-transfected E10 cells. Note the loss of colocalization of Caveolin-1 and P2X 7 in Cav-1 shRNA treated cells. Caveolin-1 and ... immunofluorescence of Caveolin-1 and P2X 7 in alveolar epithelial E10 cells To examine the possible colocalization of the puriner- gic P2X 7 receptor with C...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Characterization of chitinase-like proteins (Cg-Clp1 and Cg-Clp2) involved in immune defence of the mollusc Crassostrea gigas docx
... of the sole Glyco_18 domain, the C-terminal tail of C. gigas CLPs may not noticeably contribute to the structure and the function of these proteins. Interestingly, Cg-Clp1 and Cg-Clp2 C-terminal ... Oyster chitinase-like proteins FEBS Journal 274 (2007) 36463654 ê 2007 The Authors Journal compilation ª 2007 FEBS 3651 Characterization of chitinase-like protei...
Ngày tải lên: 19/02/2014, 00:20
Tài liệu Báo cáo khoa học: Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia pptx
... Adaptive changes in the expression of nuclear and mitochondrial encoded subunits of cytochrome c oxidase and the catalytic activity during hypoxia C. Vijayasarathy 1, * ,† , ... though the catalytic efficiency of the enzyme (TN for cytochrome c oxidase) remained nearly the same. Increased glycolytic flux and alterations in the kinet...
Ngày tải lên: 20/02/2014, 23:20
Báo cáo khoa học: Protein transport in organelles: The composition, function and regulation of the Tic complex in chloroplast protein import pptx
... stabilization of the Toc /Tic/ preprotein supercomplex. In this model, Tic1 10 forms the channel protein and also acts in the recruitment of Hsp93 in concert with the co-chaperone Tic4 0. The TPR domain of Tic4 0 ... 1175 MINIREVIEW Protein transport in organelles: The composition, function and regulation of the Tic complex in chlorop...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Protein transport in organelles: Protein transport into and across the thylakoid membrane pptx
... vivo but miss- ing from in vitro experiments. Transport into the thylakoid membrane Nuclear encoded proteins destined to be inserted into the thylakoid membrane are transported by either an assisted, ... chloroplast proteins are nuclear encoded and require transport into the chloro- plast. Whether synthesized in the cytosol or the chloro- plast stroma, a sub-...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Universal positions in globular proteins From observation to simulation ppt
... E.N. (2001) Protein folding: looping from hydrophobic nuclei. Proteins 45, 3 46–350. 12. Berezovsky, I.N. (2003) Discrete structure of van der Waals domains in globular proteins. Protein E ngineering 16, ... Carboxypeptidase inhibitor small 3cytO Mitochondrial cytochrome c a 1ast Astacin a + b 1icfI MHC class II p41 invariantchain fragment small 3c2c Cytochrome c2 a 1dtp Diphtheria t...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: The association of viral proteins with host cell dynein components during virus infection pdf
... the fusion of the viral membrane with the plasma membrane of the cell. During passage through the cytosol, the viral RNA genome is reverse transcribed into DNA within a structure named the reverse ... [118]. Conclusions In the past few years, numerous studies of virus host interactions have revealed the role of the dynein motor and the integrity of...
Ngày tải lên: 14/03/2014, 22:20
Báo cáo khoa học: Intrinsic disorder and coiled-coil formation in prostate apoptosis response factor 4 pptx
... (2006) Androgen receptor and prostate apoptosis response factor- 4 target the c-FLIP gene to determine survival and apoptosis in the prostate gland. J Mol Endocrinol 36, 46 3 48 3. 36 Vetterkind S, ... folding and binding with alpha-helix-forming molecular recog- nition elements. Biochemistry 44 , 1 245 4–1 247 0. 41 Linding R, Jensen LJ, Diella F, Bork P, Gibson TJ &a...
Ngày tải lên: 16/03/2014, 02:20
Báo cáo khoa học: Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein doc
... 2399 Nucleosome positioning in relation to nucleosome spacing and DNA sequence-specific binding of a protein Rama-Haritha Pusarla*, Vinesh Vinayachandran* and Purnima Bhargava Centre for Cellular ... of the R3 pair bound to L1 and L2. Turning a gene into an active state from a state of inactivation often involves binding of a single activator mo...
Ngày tải lên: 16/03/2014, 10:20
Báo cáo khoa học: "Multiple Interpreters in a Principle-Based Model of Sentence Processing" potx
... fined by allowing non-terminal daughters to dominate a recursive instance of the schema. It is interesting to note that, for phrase structure at least, the relevant principles of grammar can ... case-mark(C-Nodea) or, ii) C-NodeA - head(Chain) * ease-mark(C-Nodea) In an argument Chain, <C-Nodes co []> , theta-mark(C-Node0) In describing the representation of a Chain...
Ngày tải lên: 18/03/2014, 02:20
Báo cáo khóa học: Genetic defects in fatty acid b-oxidation and acyl-CoA dehydrogenases Molecular pathogenesis and genotype–phenotype relationships ppt
... variations in many cases are Ó FEBS 2004 Genetic defects in fatty acid oxidation (Eur. J. Biochem. 271) 475 MINIREVIEW Genetic defects in fatty acid b-oxidation and acyl-CoA dehydrogenases Molecular pathogenesis ... the world for providing genetic and cell material for the studies and certain of them for inspiring discussions concerning genotype–pheno...
Ngày tải lên: 23/03/2014, 12:20
Báo cáo khoa học: Collective behavior in gene regulation: Metabolic clocks and cross-talking doc
... that Metabolic cycles M. M. Bianchi 2358 FEBS Journal 275 (2008) 23562363 ê 2008 The Author Journal compilation ê 2008 FEBS MINIREVIEW Collective behavior in gene regulation: Metabolic clocks and ... for a single cell over time and the average over the statistical ensemble of individuals at a given time coincide. In the ergodic hypothesis, genes are generally divided in...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: "Intrinsic disorder in Viral Proteins Genome-Linked: experimental and predictive analyses" pot
... purposes) Virology Journal Open Access Research Intrinsic disorder in Viral Proteins Genome-Linked: experimental and predictive analyses Eugénie Hébrard* 1 , Yannick Bessin 2 , Thierry Michon 3 , Sonia Longhi 4 , ... analyses at intra -and interspecies levels showed the diversity of intrinsic disor- der in VPgs. Like many IDPs, VPg ID domains may play a role in pro- tein...
Ngày tải lên: 12/08/2014, 04:21