... involves capture of the electron into an amide carbonyl group that is hydrogen bonded to the protonated side chain of a basic amino acid. The resulting radical anion abstracts a proton and gen- erates ... C-termi- nus of the protein, and the presence of PTMs such as methylation (14 Da), dimethylation or formylation (28 Da), trimethylation or acetylation (42 Da), and glutamyl...
Ngày tải lên: 18/02/2014, 16:20
... Journal 273 (2006) 47424753 ê 2006 The Authors Journal compilation ê 2006 FEBS Application of a fluorescent cobalamin analogue for analysis of the binding kinetics A study employing recombinant human ... below. Competitive binding of CBC and Cbl, calculation of k + We have tested the application of the fluorescent ana- logue CBC as a...
Ngày tải lên: 19/02/2014, 05:20
Báo cáo khoa học: Analysis of DNA-binding sites on Mhr1, a yeast mitochondrial ATP-independent homologous pairing protein potx
... K, Kagawa W, Takata M, Takeda S, Yokoyama S & Shibata T (2001) Homologous- pairing activity of the human DNA-repair proteins Xrcc3.Rad51C. Proc Natl Acad Sci USA 98, 5538–5543. 20 Kagawa W, ... ssDNA (5Â-ACGGGTGGGGTGGACATTGAC GAAGGCTTGGAAGACTTTCCGCCGGAGGAGGAGT TGCCGTTTTAATAAGGATC-3Â) (Hokkaido System Science, Hokkaido, Japan) and /X174 circular ssDNA (New England BioLabs, MA, USA) we...
Ngày tải lên: 06/03/2014, 09:22
Báo cáo khoa học: "Analysis of Selective Strategies to Build a Dependency-Analyzed Corpus" pptx
... Makoto Nagao. 199 4a. KN Parser: Japanese dependency/case structure ana- lyzer. In Proceedings of Workshop on Sharable Nat- ural Language Resources, pages 48–55. Sadao Kurohashi and Makoto Nagao. ... using several fundamental selective strategies for a dependency- analyzed corpus, it is necessary to provide a func- tion to build a selective sampling framework to construc...
Ngày tải lên: 17/03/2014, 04:20
Báo cáo khoa học: Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid ppt
... Characterization of a membrane-bound angiotensin-converting enzyme isoform in crayfish testis and evidence for its release into the seminal fluid Juraj Simunic, Daniel Soyez and Ne ´ dia Kamech Equipe Biogene ` se ... cDNA, obtained by 3Â-to5Â RACE of testis RNAs, codes for a predicted one-domain protein similar to the mammalian germinal isof...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: "Establishment of a bovine leukemia virus-free dairy herd in Korea" potx
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: " Influence of ascorbic acid on BUN, creatinine, resistive index in canine renal ischemia-reperfusion injury" pps
...
Ngày tải lên: 07/08/2014, 18:21
báo cáo khoa học:" Development of a patient reported outcome scale for fatigue in multiple sclerosis: The Neurological Fatigue Index (NFI-MS)" pptx
... multi-dimensionality. The summary findings related to the analysis of each domain are given in Table 4. Physical scale Rasch analysis of the 16 Physical items identified in the PCA indicated that all item ... the response scale, the fit of individual items, item bias, and the dimensionality and targeting of the scale as a whole. In summary, fit of data t...
Ngày tải lên: 12/08/2014, 01:21
báo cáo khoa học: " Analysis of a post-translational steroid induction system for GIGANTEA in Arabidopsis" pdf
... 5'- TTGCAACTCCAAGTGCTACG-3' and 5'-GCTCGAAG- GAGTTCCACAAG-3' for GI, 5'-ACTGGTGGTGGATCAA- GAGG-3' and 5'-GAATTAGGGAACAGCCACGA-3' for CO, 5'-CTGGAACAACCTTTGGCA ... 5'-CTGGAACAACCTTTGGCA AT-3' and 5'-TACACT- GTTTGCCTGCCAAG-3' for FT, 5'-CGAAAGCTTCCTCCT- GGTTA-3' and 5'-GAGTTTTGCCCCTCACCATA-3' for SOC1,...
Ngày tải lên: 12/08/2014, 03:21
báo cáo khoa học: " Analysis of a c0t-1 library enables the targeted identification of minisatellite and satellite families in Beta vulgaris" ppt
... ATAATCATACCTCTATGCCTATTCCAAGTTCTAATGGCTAATGCAAGTCCT AAAATACTCATTTAAACTTTCTACTACATGGTTGTAAGATTCTAAGCAAGT TTAATACACTTAGCCAATTAAAATGAGAAAAACTAAGCCATTTCGAGCCGT TTTTTGGGTTTCATGTTCCT HinfI -satellite 325 2 ... TGTGACTTGTAACATTGCGCGGGTGCTTGGCACCATTTGCGTTACCTCAAA AAGCCTTTGAACACCCCAATTATTCATTTCTCGCGAAATCCAAAATTGCCT CGAAATGAACGTAAAGGCATCCACATATTTGTTCCAAGCCACATGACTCCT TTACATTGACCTCCTATGTCCCTAGGAGGCATCC...
Ngày tải lên: 12/08/2014, 03:21
Báo cáo khoa học: "Development of a RVFV ELISA that can distinguish infected from vaccinated animals" pps
... pro- vide an easily accessible assay that can be reliably used to distinguish animals that are infected with WT virus from animals that have been vaccinated. This differential ability is important ... AA, Al-Rabeah AM, Turkistani AM, Al-Sayed MO, Abodahish AA, Khan AS, Ksiazek TG, Shobokshi O: Rift Valley fever epidemic in Saudi Arabia: epi- demiological, clinical, and laborato...
Ngày tải lên: 12/08/2014, 04:21
Báo cáo khoa học: " Analysis of a conserved RGE/RGD motif in HCV E2 in mediating entry" pps
... blot analysis. Detection of p24 capsid protein was performed as a loading control. A EnvA VSVG HCV WT AGE KGE RAE RGD RGA RGK ~70kDa E2 actin EnvA VSVG HCV WT AGE KGE RAE RGD RGA RGK ~70kDa E2 actin ~70kDa E2 actin ... purposes) Virology Journal Open Access Research Analysis of a conserved RGE/RGD motif in HCV E2 in mediating entry Katharina B Rothwan...
Ngày tải lên: 12/08/2014, 04:21
báo cáo khoa học: " Analysis of non-TIR NBS-LRR resistance gene analogs in Musa acuminata Colla: Isolation, RFLP marker development, and physical mapping" potx
... 1 of 15 (page number not for citation purposes) BMC Plant Biology Open Access Research article Analysis of non-TIR NBS-LRR resistance gene analogs in Musa acuminata Colla: Isolation, RFLP marker ... new R -gene specificities may evolve. Segregation of polymorphic bands in a subset of M. acuminata mapping population F1 progenyFigure 4 Segregation of pol...
Ngày tải lên: 12/08/2014, 05:20
Báo cáo khoa học: "Validation of a method to partition the base deficit in meningococcal sepsis: a retrospective study" ppt
... for the group as a whole (mean pH 7.31, BD tot -7.4). The unmeasured anion- related base deficit was greater than the total base deficit; this was predominantly due to the alkalinising effect of ... read and approved the final manuscript. Additional files BD alb = base deficit due to albumin; BD Cl = base deficit due to chlo- ride; BD tot = total base...
Ngày tải lên: 12/08/2014, 22:22
Báo cáo khoa học: " Introduction of a rapid response system: why we are glad we MET" pps
... patients. Analysis of the circadian variation of activation of the MET service revealed that the majority of calls occurred during nursing handover, with a peak at 8:00–8:30 hours [15]. These observations ... intensive care admissions in Australia and New Table 1 Important components of the success of the MET service at The Austin Hospital Collection of baseline data for befor...
Ngày tải lên: 12/08/2014, 23:21