0
  1. Trang chủ >
  2. Giáo Dục - Đào Tạo >
  3. Cao đẳng - Đại học >

Báo cáo khoa học:" Hepatitis B and C in dialysis units in Kosova" pps

Báo cáo khoa học:

Báo cáo khoa học:" Hepatitis B and C in dialysis units in Kosova" pps

... ymerelezi@hotmail.com; Teuta Bicaj - teutab68@yahoo.com* Corresponding author AbstractBackground: Hepatitis < /b> B virus (HBV) and hepatitis < /b> C virus (HCV) infections are important causesof morbidity and mortality ... uni-versal precaution standards and infection control meas-ures. Available data suggest that HCV has become themost common cause of acute hepatitis < /b> in dialysis patients and dialysis staff members, ... than HCV in HD units [4].The rate of serum HBsAg seropositivity on maintenanceHD in the developed world is currently low (0–10%) butoutbreaks of acute HBV infection continue to occur in thissetting....
  • 4
  • 346
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Hepatitis B and C in dialysis units in Kosova" docx

... developed world is currently low (0–10%) butoutbreaks of acute HBV infection continue to occur in thissetting. The prevalence of HBV infection within dialysis units in developing countries appears ... Seroprevalence of hepatitis< /b> B and C in maintenance dialysis in a public hospital in adeveloping country. S Afr Med J 2003, 93(5):380-384.15. Khan LA, Khan SA: Prevalence of Hepatitis < /b> B and C markers in patients ... uni-versal precaution standards and infection control meas-ures. Available data suggest that HCV has become themost common cause of acute hepatitis < /b> in dialysis patients and dialysis staff members,...
  • 4
  • 353
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis B virus genotypes and evolutionary profiles from blood donors from the northwest region of China" docx

... markers, including HBs, anti-HBs, anti-HBe, HBe and anti-HBs, were performed byELISA using an automatic enzyme detection system(Tecan, Swiss) and a commercial kit (InTec Products,China) according ... immediately upon acceptancecited in PubMed and archived on PubMed Central yours — you keep the copyrightSubmit your manuscript here:http://www.biomedcentral.com/info/publishing_adv.aspBioMedcentralVirology ... from blood donorcandidates from northwest China were determined. The HBV strains were most clustered into B and C genotypes and could not be clustered into similar types from reference sequences.Subsequent...
  • 7
  • 351
  • 0
Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

Báo cáo khoa học: HIP/PAP, a C-type lectin overexpressed in hepatocellular carcinoma, binds the RIIa regulatory subunit of cAMP-dependent protein kinase and alters the cAMP-dependent protein kinase signalling ppt

... by bovine heartPKA. The sense primer (5¢-GTCGAATTCCAAGGTGAAGAACCCCAG-3¢) was located at nucleotides 63–90of the coding sequence, and the antisense primer (5¢-TGCTGAATTCCCTCCCTCCTGCACTAGTCAG-3¢)over-lapped ... demaugre@necker.frAbbreviations: CRD, carbohydrate-binding domain; CRE, cAMPresponse element; HCC, he patocellular carcinoma; HMK peptide,peptide phosphorylatable by heart muscle kinase; PKA, cAMP-dependent ... zipper protein that interacts with c- Fos. Science 256, 1014–1018.18. Singh, H., Clerc, R.G. & L eBowitz, J.H. (1989) Molecular cloningof sequence-speci c DNA binding proteins using recognition...
  • 9
  • 310
  • 0
Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

Báo cáo khóa học: NF-jB- and c-Jun-dependent regulation of human cytomegalovirus immediate-early gene ppt

... 5¢-AGGTACCCAATATTGGCCATTAGCC-3¢;CMVIE()507)5¢-CGGTACCTGGCCCGCCTGGCTGAC-3¢;CMVIE()300) 5¢-TGGTACCATGCCCAGTACATGACCTTA-3¢;CMV IE ()185) 5¢-TGGTACCCGGTTTGACTCACGGGGATT-3¢;CMVIE()130) 5¢-TGGTACCTTGTTTTGGCACCAAAATCA-3¢ and 3¢ primer, CMV ... mNF-jB1, 5¢-GTAACGCCAATAtcGAtTTTCCATTG-3¢; mNF-jB2, 5¢-ACATGACCTTAatcGAtTTTCCTACT-3¢; mNF-jB3, 5¢-GTTTGACTCAatcGatTTTCCAAGTC-3¢;mNF-jB4, 5¢-CCAAAATCAAatcGatTTTCCAAAATG-3¢;mAP-1,5¢-TAGCGGTTTatCgatCGGGGATTTCC-3¢. ... GC(indicated by bold lettering) are as follows: CpG-ODN1826(S-1, TCCATGAGCTTCCTGACGTT); 1826(S-2,TCCATGACGTTCCTGAGCTT) and 1826(S-3, TCCATGAGCTTCCTGAGCTT). The non-CpG-ODN 2041(CTGGTCTTTCTGGTTTTTTTCTGG)...
  • 12
  • 330
  • 0
Báo cáo khoa học:

Báo cáo khoa học: " Hepatitis B virus genotypes/subgenotypes in voluntary blood donors in Makassar, South Sulawesi, Indonesia" ppt

... | | AB033555-Indonesia- (B) ATGAGTGGGAGGAGTTGGGGGAGGAGATCAGGTTAAAGGTCTTTGTACTAGGAGGCTGTAGGCATAAATTGGTCTGTTCACCAGCACCATGCAACTTTTTCACCTCTGCCTAATCATCTCATGTTCATGTCCTATTGTTCAAGCCTCCAAGCTGTGC DQ993709-Taiwan- (B) ... CCGGCAGATGAGAAGGCACAGACGG HBX/HBPol 1549–1574HBPr374 Reverse GTTCCGCAGTATGGATCGGCAGAGG HBPol 1255–12794 (319) HBPr110 Forward CCTCTGCCGATCCATACTGCGGAAC HBPol 1255–1279HBPr113 Reverse CCGGCAGATGAGAAGGCACAGACGG ... associated with HCC was low [40].If BCP mutation is strongly associated with clinical out-come of liver disease including HCC, the incidence ofHCC must be high in India. In fact, the HCC incidencewas...
  • 9
  • 479
  • 0
Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf

Báo cáo khoa học: Efficient and targeted delivery of siRNA in vivo pdf

... permeation into desired tissues, speci c bindingto target cells and optimized intracellular trafficking.Recent advances clearly indicate that interdisciplinaryapproaches using biology, chemistry and ... and successfully inhibited theexpression of VEGF, thereby suppressing the growthof hepatocarcinoma tumors in mice [87]. In addition,no noticeable increase in inflammatory cytokines,including ... TAT–siRNA conjugates from the endosome, resulting in enhanced gene silencing efficiency. Chloroquine and Table 1. siRNA delivery systems for RNAi in vivo. BCL-2, B- cell lymphoma 2; Cyb1, cyclin B1 ; CyD1,...
  • 14
  • 599
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "COMMON TOPICS AND COHERENT SITUATIONS: INTERPRETING ELLIPSIS IN THE CONTEXT OF DISCOURSE INFERENCE" ppt

... supports Clinton, and Mary 0 Bush, and Fred does too. Sag defines an alphabeiic variance condition that cor- rectly predicts that sentence (25) is infelicitous, but in- correctly predicts that ... well with those employing our Common Topic inference, and likewise Cause or effect and Contiguity with our Coherent Situation inference. 9Following Hobbs, by al and bi being similar we mean ... to ] b. # Clinton was introduced by John because Mary had refused to, and Fred did too. [ in- troduced Clinton because Mary had refused to ] The current approach accounts for these cases....
  • 8
  • 511
  • 0
Báo cáo khoa học: Nature, nurture and neurology: gene–environment interactions in neurodegenerative disease docx

Báo cáo khoa học: Nature, nurture and neurology: gene–environment interactions in neurodegenerative disease docx

... experiments in rats showed that corticalweight and thickness, however, increase with enrich-ment [21]. This increase in cortical size could be causedeither by enhanced dendritic branching and synapto-genesis ... enrichment include increases ofgreater than threefold, indicating increased capacityfor injury-associated plastic changes in the enrichedcortex [38].Environmental enrichment also causes molecularchanges ... E, Chase K, McIntyre C, BoyceFM, Campbell M, Cadigan BA, Warzecki L, TagleDA, Reddy PH et al. (2001) Changes in cortical and striatal neurons predict behavioral and electrophysio-logical abnormalities...
  • 15
  • 504
  • 0
Báo cáo khoa học:

Báo cáo khoa học: "Comparing Objective and Subjective Measures of Usability in a Human-Robot Dialogue System" potx

... not include any such input-processingfactors in our models.Other objective factors that might be relevantfor predicting user satisfaction in the current studyinclude a range of non-verbal behaviour ... sub-jects built the windmill correctly, while both ofthe L-shapes were built with 90% accuracy. Forthe second occurrence of the snowman and the L-shape, the Memory column indicates the percent-age ... two classes of measures.Task success Table 3 shows the success rate forassembling each object in the sequence. Objects in italics represent sub-components, as follows:the first snowman was constructed...
  • 9
  • 310
  • 0

Xem thêm

Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Báo cáo quy trình mua hàng CT CP Công Nghệ NPVGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThơ nôm tứ tuyệt trào phúng hồ xuân hươngKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Quản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Nguyên tắc phân hóa trách nhiệm hình sự đối với người dưới 18 tuổi phạm tội trong pháp luật hình sự Việt Nam (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)TÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ