Báo cáo khoa học: "Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in Huh-7 cells with a defective Jak-Stat pathway" pdf
... was amplified using sense and anti-sense overlapping primers (S/7529/GFP- 5’-GCCTCCTCTATGCCCCCCATGGT- GAGC AAGGGCGAG-3’ and (AS/7547-7564/GFP 5’- TCCAGGCTCCCCCTCGAGCTTGTACA GCTCGTCCAT-3’). In the third ... 7:36 http://www.virologyj.com/content/7/1/36 Page 9 of 16 RESEA R C H Open Access Impaired antiviral activity of interferon alpha against hepatitis C virus 2a in...
Ngày tải lên: 12/08/2014, 04:21
... 22.6 Cordia dichotoma Boraginaceae Clammy cherry, lasoori, gunda, Anti-inflammatory Leaves 14.1 Colocasia esculenta Araceae Kachalu, Arvi Anti-diarrhea, anorexia, antipyretic. Leaves 21.5 Momordica charantia Cucurbitaceae ... organic solvents. These compounds were analysed for in- vitro antiviral activity against HCV NS3- SP, among which Epicatechin and Epigallocatechin and their dimer...
Ngày tải lên: 11/08/2014, 21:21
... Irshad-ur Rehman, Madiha Akram, Sobia Manzoor, Haji Akbar, Shazia Rafiqe and Sheikh Riazuddin Address: National Centre of Excellence in Molecular Biology, 87-West Canal Bank Road Thokar Niaz Baig ... HCV infections in North and South America, Europe, Russia, China, Japan, Australia, New Zealand and India [6,7]. Type 4 is prevalent in Egypt, North Africa, Central Africa, and the Middl...
Ngày tải lên: 12/08/2014, 04:20
Tài liệu Báo cáo khoa học: Multi-targeted activity of maslinic acid as an antimalarial natural compound pdf
... processes with a single compound, a new concept in antimalarial research. Introduction As long as effective vaccines against malaria remain unavailable, the search for new antimalarial drugs is still ... Accordingly, an additional inhibition assay was performed using P. falciparum protein extracts and including cathepsin D (an aspartic protease) and the aspartic protease inhibitor p...
Ngày tải lên: 14/02/2014, 14:20
Tài liệu Báo cáo khoa học: Intrinsic GTPase activity of a bacterial twin-arginine translocation proofreading chaperone induced by domain swapping ppt
... 525 Intrinsic GTPase activity of a bacterial twin-arginine translocation proofreading chaperone induced by domain swapping David Guymer 1 , Julien Maillard 2 , Mark F. Agacan 1 , Charles A. Brearley 3 and ... GTPases bind very stably to GTP and have a very low intrinsic level of GTPase activity, and also require the action of GTPase activating proteins (GAPs), or the interaction...
Ngày tải lên: 16/02/2014, 09:20
Tài liệu Báo cáo khoa học: The phosphatase activity of the isolated H4-H5 loop of Na+/K+ ATPase resides outside its ATP binding site docx
... usually complementary. The primer sequence of the N398D construct was GCTGACACCA CAGAG GATCAGAGTGGGGTCTCC and that of the D36 9A construct C CACCATCTGCTCC GCCAAGACT GGAACTCTGAC. The underlined ... 5¢-CTCCTGTGACCATGATGACCTAAATCCC AGC-3¢; I390–S601 sense with BglII site: 5¢-GC GT AGA TCTATCCATGAAGCTGACACCACAG-3¢;antisense with EcoRI restriction site: 5¢-AT GAATTCGCGCTGCG GCATTTGCCCAC...
Ngày tải lên: 19/02/2014, 16:20
Báo cáo khoa học: Investigating the role of the invariant carboxylate residues E552 and E1197 in the catalytic activity of Abcb1a (mouse Mdr3) docx
... (5¢-CTGGACGA TGCAACATC-3¢) and E1197Nf (5¢-CTGGAC AACGCAACATCAG-3¢) with primer pHIL– 3¢r(5¢-GCAAATGGCATTCTGACATCC-3¢). The amplifi- cation products were purified on gel, mixed, denatured at 94 C for ... (5¢-GATGTTGC ATCGTCCAGAAG-3¢) and E1197Nr (5¢-GATGTTGC GTTGTCCAGAAG-3¢). A second over- lapping mdr3 cDNA fragment was amplified using muta- genic oligos E1197Af (5¢-CTGGACG CAGCAACATC-3¢),...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa học: The antibiotic activity of cationic linear amphipathic peptides: lessons from the action of leucine/lysine copolymers on bacteria of the class Mollicutes doc
... also for the antimicrobial activity of these peptides. In this work, we have taken advantage of the fact that bacteria of the class Mollicutes are devoid of an outer membrane and of a cell wall, ... bacteria from setting up appropriate countermeasures and lead to a rapid cell death if the peptide concentration is maintained above a critical threshold. In the case of ba...
Ngày tải lên: 23/03/2014, 17:21
Báo cáo khoa học: Ion channel activity of brain abundant protein BASP1 in planar lipid bilayers pptx
... the form of discrete unitary conductance changes with evi- dence of open and closed states that are characteristic of ion channels. It is notable that cholesterol, which is a main component of lipid ... Neurosci 4, 38–43. 30 Odagaki S, Kumanogoh H, Nakamura S & Maekawa S (2009) Biochemical interaction of an actin-capping protein, CapZ, with NAP-22. J Neurosci Res 87 , 1980...
Ngày tải lên: 28/03/2014, 23:20
Báo cáo khoa học: The enzymatic activity of SR protein kinases 1 and 1a is negatively affected by interaction with scaffold attachment factors B1 and 2 pot
... SRPK1, using as primers: forward: 5¢-TCC CCCGGGAATTTTCT TGTTATTCCCCTTGAG-3¢, containing the underlined SmaI site and reverse: 5¢-CCGAG GAATTCGGAGTTAA GCCAAGGGTGCCG-3¢, containing the underlined EcoRI site. ... containing the underlined BamHI site and reverse: 5¢-TCC CCCGGGAG CAGTACTGACTGCAGATCC-3¢, containing the under- lined SmaI site. The cDNA coding for the C- terminus was also amplified b...
Ngày tải lên: 30/03/2014, 01:20