Báo cáo khoa học: " A rapid and efficient method for studies

Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

... at room temperature demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and HeLa remained at the ... developed the protocol for the binding assay, radiola- beled and purified the clinical isolate and performed the radioactive measured binding assay. SI participated in...

Ngày tải lên : 12/08/2014, 04:21

6
230
0

Báo cáo khoa học: "A Latent Dirichlet Allocation method for Selectional Preferences" pptx

... nouns that contain only words present in the TEXTRUNNER relation string. These depen- dency paths were then matched against each pair in the DIRT database, and all pairs of associated relations ... Proceedings of the National Academy of Sciences of the United States of America. Oren Etzioni, Michael Cafarella, Doug Downey, Ana maria Popescu, Tal Shaked, Stephen Soderl, Dan...

Ngày tải lên : 07/03/2014, 22:20

11
411
0

Báo cáo khoa học: "A Morphological Analysis Based Method for Spelling Correction" docx

Ngày tải lên : 09/03/2014, 01:20

1
341
0

Báo cáo khoa học: "A Generalized-Zero-Preserving Method for Compact Encoding of Concept Lattices" pot

... ERG contain thou- sands of types. We use binary constraints between every pair of types, for a total of millions of constraints and these are variables and constraints over a domain of sets, ... value from the bit vector encodings. We have evaluated the re- sulting encodings on the ERG’s type system, and examined the performance of the associated uniﬁ- cat...

Ngày tải lên : 17/03/2014, 00:20

10
410
0

Tài liệu Báo cáo khoa học: "A Uniﬁed Syntactic Model for Parsing Fluent and Disﬂuent Speech∗" ppt

... is the fact that there is often a good deal of overlap in words between the reparandum and the alteration, as speakers may trace back several words when restarting after an er- ror. For instance, ... modiﬁed for use in a special repair grammar, which not only reduces the amount of available training data, but violates our intuition that most reparanda are ﬂuent up until...

Ngày tải lên : 20/02/2014, 09:20

4
581
0

Báo cáo khoa học: A zinc ﬁnger HIT domain-containing protein, ZNHIT-1, interacts with orphan nuclear hormone receptor Rev-erbb and removes Rev-erbb-induced inhibition of apoCIII transcription potx

... ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢- GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA CTGAGGCAGTCTCG-3¢. These ... was identiﬁed as a nuclear protein. Serial trun- cated fragments and substitution mutations established a putative nuclear localization signal at amino acids 38–47 of ZNHIT...

Ngày tải lên : 07/03/2014, 05:20

12
423
0

Báo cáo khoa học: "A Stacked Sub-Word Model for Joint Chinese Word Segmentation and Part-of-Speech Tagging" potx

... (Ramshaw and Marcus, 1995) and the Start/End representation (Kudo and Matsumoto, 2001) are popular. For example, the label B-NN indicates that a character is located at the begging of a noun. Using this ... predict the POS tag with positional information for each character. Each character can be assigned one of two possi- ble boundary tags: “B” for a characte...

Ngày tải lên : 17/03/2014, 00:20

10
412
0

Báo cáo khoa học: " A simple pattern-matching algorithm for recovering empty nodes and their antecedents∗" pot

... recall measures for evaluating parse accuracy do not mea- sure the accuracy of empty node and antecedent re- covery, but there is a fairly straightforward extension of them that can evaluate ... performance av- eraged over all empty node types was approximately the same as the pattern-matching algorithm. As a comparison of tables 3 and 4 shows, the pattern-matching alg...

Ngày tải lên : 17/03/2014, 08:20

8
346
0

Báo cáo khoa học: "A Latent Topic Extracting Method based on Events in a Document and its Application" pot

... the relationships between objects and their evaluations, therefore, it is said that they are appropriate for the performance evaluation of our method because the relationship is usually expressed ... Discovery and Data Mining:301–310. Solomon Kullback and Richard A. Leibler. 1951. On Information andSufﬁciency. Annuals of Mathematical Statistics, 22:49–86. Thomas L. Griﬁ...

Ngày tải lên : 23/03/2014, 16:20

6
397
0

Báo cáo khoa học: "A new data processing system for root growth and ramification analysis: description of methods" pot

... computing of growth and ramification parameters. Table I shows the final data structure of the simplified example from Fig. 1. Growth and branching pattern analysis Statistical processing ... (Belgrand et al., 1987). This new data processing system consists of 3 successive stages: 1) semi-automated data acquisition; 2) data storage and growth...

Ngày tải lên : 09/08/2014, 02:21

5
251
0