Báo cáo khoa học: " A rapid and efficient method for studies of virus interaction at the host cell surface using enteroviruses and real-time PCR" potx

... at room temperature demonstrating that incubation at a higher temperature reduced unspecific attachment of this virus to CHO cells, while attachment to CHO-CAR, CHO-DAF and HeLa remained at the ... developed the protocol for the binding assay, radiola- beled and purified the clinical isolate and performed the radioactive measured binding assay. SI participated in...

Ngày tải lên: 12/08/2014, 04:21

... nouns that contain only words present in the TEXTRUNNER relation string. These depen- dency paths were then matched against each pair in the DIRT database, and all pairs of associated relations ... Proceedings of the National Academy of Sciences of the United States of America. Oren Etzioni, Michael Cafarella, Doug Downey, Ana maria Popescu, Tal Shaked, Stephen Soderl, Dan...

Ngày tải lên: 07/03/2014, 22:20

Ngày tải lên: 09/03/2014, 01:20

... ERG contain thou- sands of types. We use binary constraints be- tween every pair of types, for a total of millions of constraints and these are variables and con- straints over a domain of sets, ... value from the bit vector encodings. We have evaluated the re- sulting encodings on the ERG’s type system, and examined the performance of the associated unifi- cat...

Ngày tải lên: 17/03/2014, 00:20

... is the fact that there is often a good deal of overlap in words between the reparandum and the alteration, as speakers may trace back several words when restarting after an er- ror. For instance, ... modified for use in a special repair grammar, which not only reduces the amount of available training data, but violates our intuition that most reparanda are fluent up until...

Ngày tải lên: 20/02/2014, 09:20

... ZNHIT-1 The oligonucleotides encoding the ZNHIT-1 siRNA were 5¢- GATCCGAGACTGCCTCAGTTTGATTCAAGAGATCA AACTGAGGCAGTCTCTTTTTT-3¢ and 5¢-AGCTTAAA AAAGAGACTGCCTCAGTTTGATCTCTTGAATCAAA CTGAGGCAGTCTCG-3¢. These ... was identified as a nuclear protein. Serial trun- cated fragments and substitution mutations established a putative nuclear localization signal at amino acids 38–47 of ZNHIT...

Ngày tải lên: 07/03/2014, 05:20

... (Ramshaw and Marcus, 1995) and the Start/End representation (Kudo and Matsumoto, 2001) are popular. For example, the label B-NN indicates that a character is located at the begging of a noun. Using this ... predict the POS tag with positional information for each character. Each character can be assigned one of two possi- ble boundary tags: “B” for a characte...

Ngày tải lên: 17/03/2014, 00:20

... recall measures for evaluating parse accuracy do not mea- sure the accuracy of empty node and antecedent re- covery, but there is a fairly straightforward extension of them that can evaluate ... performance av- eraged over all empty node types was approximately the same as the pattern-matching algorithm. As a comparison of tables 3 and 4 shows, the pattern-matching alg...

Ngày tải lên: 17/03/2014, 08:20

... the relationships be- tween objects and their evaluations, therefore, it is said that they are appropriate for the performance evaluation of our method because the relationship is usually expressed ... Discovery and Data Mining:301–310. Solomon Kullback and Richard A. Leibler. 1951. On Information andSufficiency. Annuals of Mathematical Statistics, 22:49–86. Thomas L. Grifi...

Ngày tải lên: 23/03/2014, 16:20

... computing of growth and ramification parameters. Table I shows the final data structure of the simplified example from Fig. 1. Growth and branching pattern analysis Statistical processing ... (Belgrand et al., 1987). This new data processing system consists of 3 successive stages: 1) semi-automated data acquisition; 2) data storage and growth...

Ngày tải lên: 09/08/2014, 02:21