Báo cáo khoa học: " A geminiviral amplicon (VA) derived from

Báo cáo khoa học: " A geminiviral amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector" pps

... amplicon (VA) derived from Tomato leaf curl virus (ToLCV) can replicate in a wide variety of plant species and also acts as a VIGS vector Prerna Pandey, Nirupam R Choudhury and Sunil K Mukherjee* Address: ... constructs in tomato plants. (A) Total DNA was isolated from the tomato leaves agroinfiltrated with VIGS, VA(AC2M), VA(AC4...

Ngày tải lên : 12/08/2014, 04:20

13
428
0

Báo cáo khoa học: An asymmetric ion channel derived from gramicidin A Synthesis, function and NMR structure ppt

... an asymmetric structural motif in a linked gA derivative. Mini-gA (11 amino- acid residues, denoted as chain A) and gA (15 residues, denoted as chain B) are linked head-to-head by succinic acid. Results Synthesis Synthesis ... structural motif: asymmetric with similarity in chains A and B (chain B ¼ Val-Gly-Ala-d-Leu-chainA; Fig. 1). As a result, all the amino-acid resi...

Ngày tải lên : 30/03/2014, 15:20

12
446
0

Báo cáo khoa học: "Pulmonary intravascular lymphoma diagnosed by 18fluorodeoxyglucose positron emission tomography-guided transbronchial lung biopsy in a man with long-term survival: a case report" pot

... involvement of intravascular lymphoma that presents no abnormality in a computed tomography scan. Case presentation: We report the case of a 61-year-old Japanese man who had pulmonary intravascular lymphoma ... Takimoto T, Nakata S, Shiga J, Nagate Y, Nakagawa T, Take H, Katagiri S: Intravascular large B-cell lymphoma presenting pulmonary arterial hypertension as an initial manife...

Ngày tải lên : 10/08/2014, 23:21

6
181
0

Tài liệu Báo cáo khoa học: Activated Rac1, but not the tumorigenic variant Rac1b, is ubiquitinated on Lys 147 through a JNK-regulated process docx

... HA–Rac1bL61 and 6His–myc–Ub as indicated. Proteasomal degradation of Rac1L61 and Rac1b (right panel). Proteasomal degradation was assessed by determining Rac1L61, Rac1bWT and Rac1bL61 accumulation in ... exchange activity, impaired intrinsic Fig. 1. Ubiquitination and proteasomal degradation of Rac1L61 and Rac1b. (A) Activated Rac1L61 undergoes ubiquitination in HEK293 c...

Ngày tải lên : 18/02/2014, 16:20

11
469
0

Tài liệu Báo cáo khoa học: "Learning to Compose Effective Strategies from a Library of Dialogue Components" doc

... reinforcement learning and constraint-based temporal reasoning. Pro- ceedings of the 21st International Conference on Machine Learning. Konrad Schefﬂer and Steve Young. 2002. Automatic learning of dialogue ... with Reinforcement Learning Reinforcement learning refers to a class of machine learning algorithms in which an agent explores an environment and takes actions based o...

Ngày tải lên : 20/02/2014, 12:20

8
418
0

Báo cáo khoa học: 7,8-Diaminoperlargonic acid aminotransferase from Mycobacterium tuberculosis, a potential therapeutic target Characterization and inhibition studies pptx

... by Kaleidagraph software (Synergy Soft- ware, Reading, PA, USA). Amino donor The direct enzymatic assay was carried out as described above, except that AdoMet was replaced by various amines at ... at 37 °Cina ﬁnal volume of 17.5 lL. A 3.5-lL sample was withdrawn, and the residual activity was measured using the direct enzymatic assay, as described above. At the same time, the rema...

Ngày tải lên : 07/03/2014, 11:20

12
490
0

Báo cáo khoa học:Sự tương đồng và bị diệt trong ngôn ngữ xin lỗi tiếng Anh Mỹ- Việt docx

... me, sir/ma'am\; Excuse me, hul \; Pardon me\; Pardon me, sir/ma'am!; Pardon me, biil \; Begging your pardon sir/ma'am\; .Allow me sir/ma'am\; Allow inc\ + ciing vdi menh ... day tieng Anh/My bang A, B, C nhu: Headway - elementary, OUP, ciia John & Liz Soars (1993); Let's go, OUP, ciia Karen Frazier, Barbara Hoskins, Ritsuko Nakata, Steve Wilkinson (2000)...

Ngày tải lên : 23/03/2014, 03:20

9
619
1

Báo cáo khoa học: Unprecedented pathogen-inducible complex oxylipins from ﬂax – linolipins A and B docx

... of flax leaves. Galactolipids were separated and purified as described in Materials and methods. EDE content was measured by UV absorbance of MGDG and DGDG fractions at 267 nm. Average values and ... Detailed infor- mation on the treatment procedures and on the measurement of linolipin content in flax leaves is described in Materials and methods. Average values and...

Ngày tải lên : 23/03/2014, 05:22

10
387
0

Báo cáo khoa học: Long-term extracellular signal-related kinase activation following cadmium intoxication is negatively regulated by a protein kinase C-dependent pathway affecting cadmium transport ppt

... gccuccauuugauggugaagaugaa; PKCd #1, ccacu acaucaagaaccaugaguuu; and PKCd #2, ccauccacaagaaaugc aucgacaa. PKCe #1, PKCe #2 and PKC siRNAs are the ‘validated Stealth RNAi duo pak’ from Invitrogen (Cergy Pontoise, ... toxicity quantiﬁcation The release of adenylate kinase from damaged cells was used as a marker of cellular toxicity. Adenylate kinase activity was measured from a...

Ngày tải lên : 23/03/2014, 06:20

13
331
0

Báo cáo khoa học: Trợ từ Ga và Wa trong câu tiếng Nhật ppt

...

Ngày tải lên : 29/03/2014, 21:20

9
341
1