Báo cáo y học: " A novel duplex real-time reverse transcript

Báo cáo y học: " A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of hepatitis C viral RNA with armored RNA as internal control" docx

... 5'-AGCGTCTAGCCATGGCGTTAGTAT-3' 74 97 Ba 5'-TCCTCGCAATTCCGGTGTACTC-3' 161 182 Bp FAM5'-CCCCCCTCCCGGGAGAGCCATAGT-3' BHQ 121 144 ICp Cy55'-TTCCGCTGCCTGCTCAGTCGATCC-3' ... 10.1186/1743-422X-7-117 Cite this article as: Meng and Li, A novel duplex real-time reverse transcriptase-polymerase chain reaction assay for the detection of...

Ngày tải lên : 12/08/2014, 04:20

9
322
0

Báo cáo khoa học: A novel metallobridged bis(b-cyclodextrin)s ﬂuorescent probe for the determination of glutathione doc

... redox conditions change rapidly after blood collection [9,10]. Therefore, a rapid and simple method for the analysis of GSH in plasma is needed. Cyclodextrins (CDs) are a class of cyclic oligosac- charides ... ﬁnal plasma samples used in the determination of GSH were obtained. Determination of GSH in plasma and accuracy assessment by recovery experiments In order to evaluate...

Ngày tải lên : 07/03/2014, 05:20

8
429
0

Báo cáo khoa học: " Development of a fluorescent quantitative real-time polymerase chain reaction assay for the detection of Goose parvovirus in vivo" ppsx

... GTGCCGATGGAGTGGGTAAT 3084-3103 60 GPV-R ACTGTGTTTCCCATCCATTGG 3122-3143 GPV-FP 6FAM-FTCGCAATGCCA ATTTCCCGAGGP TAMRA 3098-3120 VP3-1 AAGCTTTGAAATGGCAGAGGGAGGA 3008-3033 1658 VP3-2 GGATCCCGCCAGGAAGTGCTTTATTTGA ... bacteria or viruses (other than GPV-CHv and pVP3) yielded any amplification signal, suggesting that the established FQ-PCR assay was highly specific (Fig- ure 2). The intraassay...

Ngày tải lên : 12/08/2014, 04:20

7
338
0

Báo cáo y học: "A single-tube allele specific-polymerase chain reaction to detect T315I resistant mutation in chronic myeloid leukemia patients" pdf

... (b-actin_F) (5’ -gtggggcgccccaggcacca-3’ )andb-act in_R (5’ -gtc cttaatgtcacgcacgatttc-3’ )[27].First,theAS-PCRwas optimized by varying annealing temperature (Ta) (55° to 62 C) , MgCl 2 concentration (1.0-2.5 ... fragment 2 forward primers: abl_2F (5’-tcatgacc- tacgggaacctc-3’) and reverse primers: abl_1R (5’-atactc- caaatgcccagacg-’3). The PCR reaction was performed in a volume of...

Ngày tải lên : 10/08/2014, 21:23

7
439
0

Báo cáo y học: " A formylpeptide receptor, FPRL1, acts as an efficient coreceptor for primary isolates of human immunodeficiency virus" docx

... 5'-ATGGAT- TATCAAGTGTCAAGTCCAATCTAT-3' (sense,1st–30th); and CCR5CR, 5'-TCACAAGCCCACAGATATTTCCT- GCTCCCC-3' (antisense, 1,001st–1,030th) [NM000579 ]. CXCR4: CXCR4CN, 5'-ATGGAGGGGATCAGTATATA- CACTTCAGAT-3' ... FPRL1 FPRL2 C3 AR C5 AR C5 L2 PAR4 PAR3 PAR2 PAR1 CXCR4 * CXCR1 * CXCR2 * CXCR5 * CXCR3 CCR10 D6 * CCR4 CCR1 * CCR3 * CCR2b * CCR5 * CX 3 CR1 * CCR...

Ngày tải lên : 13/08/2014, 05:21

14
304
0

Báo cáo y học: "Most nuclear systemic autoantigens are extremely disordered proteins: implications for the etiology of systemic autoimmunity" pps

... the paradoxical aspects of autoimmunity – in particular, the difficulty in identifying autoantigen-specific helper T cells that might collaborate with the B cells activated in systemic autoimmunity. The ... circular epitope can be brought into close proximity of the activated T cell, such that cytokines from this T cell, which can act only over short distances, can act in &apo...

Ngày tải lên : 09/08/2014, 07:20

15
413
0

Báo cáo y học: " Combined forced oscillation and forced expiration measurements in mice for the assessment of airway hyperresponsiveness" pot

... anesthesia was reached, as assessed by loss of withdrawal reflex and absence of response to external stimuli, the mouse was tracheostomized using an 18G metal cannula. The animal was then placed ... placed in a flow-type body plethysmograph and connected via the endotracheal cannula to a flexiVent system (SCIREQ Inc., Montreal, Canada). After initiating mechanical ventilation,...

Ngày tải lên : 12/08/2014, 11:22

13
427
0

Báo cáo y học: " A Novel Variable Number of Tandem Repeat of the Natriuretic Peptide Precursor B gene’s 5’-Flanking Region is Associated with Essential Hypertension among Japanese Females"

... 5’-AAGGAGGCACTGGGAGAGGGGAAAT-3’ (bases -1323 to -1299) and antisense, 5’- CCCCACCAAGCCAACACAGGATGGA -3’ (bases -919 to-895) were used to amplify a 429-bp product from genomic DNA (Fig. 1A) . ... 1. Characteristics of study participants Biochemical analysis Plasma total cholesterol concentrations, as well as serum creatinine and uric acid concentrations, were measured using...

Ngày tải lên : 26/10/2012, 10:04

7
612
1

Tài liệu Báo cáo Y học: A novel meta-cleavage dioxygenase that cleaves a carboxyl-groupsubstituted 2-aminophenol Puriﬁcation and characterization of 4-amino-3-hydroxybenzoate 2,3-dioxygenase from Bordetella sp. strain 10d doc

... below. Morphological and phenotypic characterization Physiological and biochemical parameters, such as Gram reaction, flagella type, catalase activity, oxidase activity and OF test, were determined using classical ... homogeneity with a 110-fold increase in speci c activity. The purified enzyme was characterized as a meta-cleavage dioxygenase that catalyzed the ring fission bet...

Ngày tải lên : 21/02/2014, 01:21

7
490
0

Tài liệu Báo cáo Y học: A novel, inducible, citral lyase puriﬁed from spores of Penicillium digitatum docx

... the case for hydratase/aldolases, which are, like citral lyase, not negatively affected by EDTA [32]. The citral lyase described in this paper is the ﬁrst example of a hydratase/aldolase acting ... pathway is analogous to that proposed for the amino acid catalysed conversion of citral at high pH [18]. For the enzymatic equivalent of this reaction the actions of...

Ngày tải lên : 21/02/2014, 01:21

8
575
0