báo cáo khoa học: " Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O glaberrima introgression lines" docx

báo cáo khoa học: " Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O. glaberrima introgression lines" docx

báo cáo khoa học: " Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O. glaberrima introgression lines" docx

... Open Access Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O. glaberrima introgression lines Andrés Gonzalo Gutiérrez 1 , Silvio ... et al.: Identification of a Rice stripe necrosis virus resistance locus and yield component QTLs using Oryza sativa × O....
Ngày tải lên : 12/08/2014, 03:21
  • 11
  • 361
  • 0
Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

Báo cáo khoa học: " Identification of a putative cellular receptor 150 kDa polypeptide for porcine epidemic diarrhea virus in porcine enterocytes" pps

... pigs of all ages, often fatality for neonates. PEDV occupies an intermediate position between two well characterized members of the coronavirus group I, human coronavirus (HCoV-229E) and transmissible ... other coronaviruses like infectious bronchitis virus (IBV) and murine coronavirus, proteolytic cleavage of peplomeric glycoproteins may play an important role in the function of...
Ngày tải lên : 07/08/2014, 17:22
  • 7
  • 463
  • 0
Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

Báo cáo khoa học: "Identification of a novel germ-line mutation in the TP53 gene in a Mexican family with Li-Fraumeni syndrome" doc

... (soft tissue sarcoma, osteosarcoma, brain tumor, pre-menopausal breast cancer, adrenocortical car- cinoma, leukemia, lung bronchioloalveolar carcinoma) prior to the age of 46 years and at least ... several different cancer types, mainly bone and soft tissue sarcoma, breast cancer, brain tumors, adrenocortical carcinoma, and leukemia [1,2]. These cancers often appear at a young age...
Ngày tải lên : 09/08/2014, 04:21
  • 7
  • 403
  • 0
báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

báo cáo khoa học: " Identification of a GCC transcription factor responding to fruit colour change events in citrus through the transcriptomic analyses of two mutants" potx

... gggaagcaggtgaagatgatgttagagaagcaattaaaatcaaaccagaaataa tttgag G K Q V K M M L E K Q L K S N Q K 721 ctttacgattataattatgtcgacagagatggtgttagaaaaggattaattgtagtttat 781 tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ... tgacaacataatcacaagaaaaacaaaaatgattgtagtaataatttaatttttttcttt 841 ccccaacaaaacctcaatgatacaaaagaattttaataaaaaaaaaaaaaaaaaaaaaaa Figure 3 Full-length cDNA and de...
Ngày tải lên : 11/08/2014, 11:21
  • 14
  • 400
  • 0
Báo cáo khoa học: "Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea" pps

Báo cáo khoa học: "Identification of a novel picornavirus related to cosaviruses in a child with acute diarrhea" pps

... showed that this virus has a genomic organization similar to other picornaviruses Genomic organization of CosavirusFigure 1 Genomic organization of Cosavirus. Schematic of initial protein products ... Additionally, 1 stool from a 64 year old woman in Scotland was found to be positive for Human Cosavirus A. Other picornaviruses have also been found in stool such as enteroviruses,...
Ngày tải lên : 12/08/2014, 04:21
  • 5
  • 321
  • 0
Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

Báo cáo khoa học: Characterization of a cathepsin L-associated protein in Artemia and its relationship to the FAS-I family of cell adhesion proteins pot

... CLAP_1:AA GATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA 1888 CLAP_2:AAGATCTTCTGAATGTGATTATATGCGGCTGTGTTTTCTAATAGATTTCTAGATACGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA (A) 48 1870 Fig. 7. Nucleotide ... CLAP_2:AAGTCTGTCGTCAAAATGTTATGAACGTCTCTTGTCATAAAGAAAGAGAACCTCTCTTTTTAGTTTGGTTTAGATATTAAGGACAGATCCAAAATATTTG 1132 * CLAP_1:AGGACCTTTTATTAGACATTTCAA...
Ngày tải lên : 07/03/2014, 16:20
  • 12
  • 772
  • 0
Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

Báo cáo khoa học: Characterization of a eukaryotic type serine/threonine protein kinase and protein phosphatase of Streptococcus pneumoniae and identification of kinase substrates doc

... JM (1983) Isolation and characterization of three new classes of transformation-deficient mutants of Streptococcus pneumoniae that are defective in DNA transport and genetic recombination. J Bacteriol ... 5’-AGGATGC CATATGATCCAAATCGGCAA-3’ NdeI stkP expression STKP-R 5’-TTGATTAT GAATTCGCTTTTAAGGAGTAGC-3’ EcoRI stkP expression STKP-RT 5’-GTAGGACA GAATTCAAGACAAGTCTACATACA-3’ EcoRI stkP...
Ngày tải lên : 16/03/2014, 18:20
  • 12
  • 466
  • 0
Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

Báo cáo khoa học: Characterization of a Cry1Ac-receptor alkaline phosphatase in susceptible and resistant Heliothis virescens larvae potx

... toxin aggregation, and pore formation. Although speculative, C ry1Ac m ay bind to GalNAcb1 fi 4on HvALP to initiate toxin oligomerization and pore forma- tion, due to putative HvALP localization ... (SBA) a/ bGalNAc 0.2 M GalNAc a/ bGal Ricinus communis (RCA-I) Galb1 fi 4GlcNAc 0.2 M Gal Gala1 fi 3Gal Dolichus biflorus (DBA) GalNAca1 fi 3GalNAc 0.2 M GalNAc GalNAca1 fi 3Gal Sophora japonica (...
Ngày tải lên : 23/03/2014, 13:20
  • 9
  • 399
  • 0
báo cáo khoa học: "Expression of a quantitative character radius incompletus, temperature effects, and localization of a mobile genetic element Dm-412 in Drosophila melanogaster" pptx

báo cáo khoa học: "Expression of a quantitative character radius incompletus, temperature effects, and localization of a mobile genetic element Dm-412 in Drosophila melanogaster" pptx

... generations of isolated cultivation of replicates a random fixation or loss of MGE localization sites could not became the dominating event. After every cycle of crosses of ... 2), containing the patterns of MGE Dm-412 localization along the segments of cytological map of Drosophila melanogaster polytene chromosomes. Designations of segme...
Ngày tải lên : 09/08/2014, 22:22
  • 21
  • 238
  • 0
báo cáo khoa học: " Identification of candidate genome regions controlling disease resistance in Arachis" doc

báo cáo khoa học: " Identification of candidate genome regions controlling disease resistance in Arachis" doc

... development, analysis of data and co-ordination of the study. All authors read and approved the final manuscript. Additional material Acknowledgements The authors would like to thank Dr. Karina Proite for ... truncatula. Plant Physiol 2008, 146(1):5-21. 60. Sato S, Nakamura Y, Kaneko T, Asamizu E, Kato T, Nakao M, Sas- amoto S, Watanabe A, Ono A, Kawashima K, Fujishiro T, Katoh M, K...
Ngày tải lên : 12/08/2014, 03:21
  • 12
  • 350
  • 0
Từ khóa: