báo cáo khoa học: " SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes" potx

... Access Database SolEST database: a "one-stop shop" approach to the study of Solanaceae transcriptomes Nunzio D'Agostino, Alessandra Traini, Luigi Frusciante and Maria Luisa Chiusano* Address: ... RK, Bouzayen M, Shibata D, Tabata S, Granell A, Botella MA, Giuliano G, Frusciante L, Causse M, Zamir D: The Tomato Sequencing Project, the First Cornerstone o...

Ngày tải lên: 12/08/2014, 03:21

... A fixed point approach to the stability of an equation of the square spiral,” Banach Journal of Mathematical Analysis, vol. 1, no. 2, pp. 148–153, 2007. 14 S M. Jung and J. M. Rassias, “Stability ... Proceedings of the National Academy of Sciences of the United States of America, vol. 27, pp. 222–224, 1941. 3 T. Aoki, “On the stability of the linear transfo...

Ngày tải lên: 22/06/2014, 11:20

... Hyers-Ulam-Rassias Stability of Functional Equations in Mathematical Analysis, Hadronic Press, Palm Harbor, Fla, USA, 2001. [10] Th. M. Rassias, “On the stability of functional equations and a problem ... stability of functional equations in several variables,” Aequationes Mathematicae, vol. 50, no. 1-2, pp. 143–190, 1995. [5] P. G ˘ avrut a, A generalization of the Hyers-Ulam-...

Ngày tải lên: 22/06/2014, 19:20

... uses an N-gram of size 1, also known as a unigram. The grammar consists of known utterances that can be made by the user. The unigram grammar is stored in a phrase database. The grammar is ... is organized according to individual words and phrases. Each phrase is placed in a table. The phrases are broken down into their individual words and placed in another table....

Ngày tải lên: 08/03/2014, 01:20

... final ISI state of the current data burst to a known value. At the same time, this also sets the initial ISI state of the next data burst to the same known value. Since blind equalization is of ... Bayesian equalization algorithm based on a Gaussian mixture parameterization of the a posteriori probability density function (pdf) of the transmitted data and the...

Ngày tải lên: 21/06/2014, 16:20

... Journal of Mathematical Analysis and Applications, vol. 251, no. 1, pp. 264–284, 2000. 64 Th. M. Rassias, “On the stability of functional equations and a problem of Ulam,” Acta Applicandae Mathematicae, ... Point Theory and Applications 56 J. M. Rassias and M. J. Rassias, “On the Ulam stability of Jensen and Jensen type mappings on restricted domains,” Journal of Mathemati...

Ngày tải lên: 21/06/2014, 20:20

... This analysis presents a unified approach as Nakagami-m fading is a general fading distribution that includes the Rayleigh, the one-sided Gaussian, the Nakagami-q, and the Rice distributions as ... that data has a normal distribution with unspecified mean and variance against the alternative data that does not have a normal dis- tribution. This test compares the empirical...

Ngày tải lên: 22/06/2014, 19:20

... apical staining of this marker was apparent in distinct areas of 3-D Huh7 aggregates (Fig. 3). Taken together, these data demonstrate that the expres- sion and distribution of cell adhesion and TJ ... particularly the interaction, organization, and stoichiometry of HCV receptors and TJ proteins. Additional analyses to determine the extent of differentiation and polarization...

Ngày tải lên: 12/08/2014, 04:21

... retinoic- acid-receptor-related orphan receptor alpha-4. Biochem J 2003, 369:583-591. 34. Kamiya A, Kinoshita T, Ito Y, Matsui T, Morikawa Y, Senba E, Nakashima K, Taga T, Yoshida K, Kishimoto T, Miyajima A: ... apical staining of this marker was apparent in distinct areas of 3-D Huh7 aggregates (Fig. 3). Taken together, these data demonstrate that the expres- sion and distribution o...

Ngày tải lên: 12/08/2014, 04:22

... CAGCAACGCAAGCTT B-g2 CAGCAACGCAAGCT B-g4 CAGCAACGCAAG A- b15 AGAGATTTTCCACAT A- b17 CTAGAGATTTTCCACAT A- b19 TGCTAGAGATTTTCCACAT D TGACAAGGATGGCTGGTGGGACTTAGCGTA E TACGCTAAGTCCCACCAGCCATCCTTGTCA F CCAGTGATCACATACGCTTTGCTAGGACATT TTTTTTTTTTTTTTTTTTTTTTTTTTTTTCAG TGCCACGTTGTATGCCCACGTTGACCG G ... GACGCTGCCGAATTCTGGCTTGCTAGGACAT CTTTGCCCACGTTGACCCG X2 CGGGTCAACGTGGGCAAAGATGTCCTAGCAA TGTAATCGT...

Ngày tải lên: 07/03/2014, 10:20