Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx
Báo cáo y học: "Differential expression of the angiogenic Tie receptor family in arthritic and normal synovial tissue" doc
... CCAng-2 CGC TCG AAT ACG ATG ACT CG TGC AGA GGC TGC AAG TGC TGG AGA A CCA CTG AGT GTT GTT TTC CAT GATTie1 GCC ACG TTC TGG CTG GAT TCA GGC CTC CTC AGC TGT GGC AT ACT TCA CTT ACG CGG GCA TTTie2 GGC ... AAC TTG ACT TCG GTG CT ACT TAC ATC CCA GGG AGC AGT ACG TGG TC GGC CTT GGT GTT GAC TCT AGC TArthritis Research Vol 4 No 3 Shahrara et al.Tie receptors constitute a family of endothelial tyrosinekinase ... analysisSynovial tissue components including lining cells,macrophages, lymphocytes, fibroblasts, smooth musclecells and endothelial cells were graded for immunostain-ing by a frequency of staining...
- 9
- 424
- 0
Báo cáo y học: "Differential expression of chemokine receptors on peripheral blood B cells from patients with rheumatoid arthritis and systemic lupus erythematosus" ppsx
... decreased expression of CXCR5 and CCR6 and increased levels of CXCR3. Thedownregulation of CXCR5 correlated with an upregulation of CXCR3. In patients with SLE, significant changes in CXCR5 expression ... observed increase in the fre-quency of CXCR3hi B cells may result from the chronic activa-tion and differentiation of B cells in patients with RA.A significant increase in the fraction of CXCR3hi ... pro-inflammatory chemokines such asCCL2, CCL3, CCL5, CCL20, CXCL9 and CXCL10, as wellBSA = bovine serum albumin; ELISA = enzyme-linked immunosorbent assay; FITC = fluorescein isothiocyanate; FACS = fluorescence-activated...
- 13
- 504
- 0
Báo cáo y học: "Differential expression of RANK, RANK-L, and osteoprotegerin by synovial fluid neutrophils from patients with rheumatoid arthritis and by healthy human blood neutrophils" doc
... [17,24,30,31]. In the context of a chronic inflam-matory reaction, RANK-L/RANK interactions between T lym-phocytes and dendritic cells and between T lymphocytes andosteoclasts explain the role of T cells ... transcriptase-polymerase chain reaction analysesGene identity Accession numberPrimer sequencesaAnnealing temperature ( C) Number of cycles (Quan.)bNumber of cycles (Qual.) c Size of PCR ... immuneresponse [7]. In the presence of certain cytokines, neutrophilsacquire a variety of biological characteristics – such as the expression of major histocompatibility complex (MHC) class IIantigens...
- 12
- 477
- 0
Báo cáo y học: "Differential expression of the FAK family kinases in rheumatoid arthritis and osteoarthritis synovial tissues" doc
... and PLCγ in COS-7 cells increases PLCγ enzymatic activity and tyrosinephosphorylation. FAK-induced PLCγ phosphorylation may bedue to FAK interaction and activation of Src family kinases [6].Our ... phosphorylation of Pyk2,Src, paxillin and PLCγ. However, M-CSF can induce osteo-clast differentiation by recruiting Pyk2, PLCγ and PI3K in aSrc-independent manner, an effect which is blocked by ... FAK israpidly tyrosine phosphorylated on cell adhesion, creating ahigh-affinity binding site for Src and thereby increasing phos-pholipase C (PLC)γ enzymatic activity [6]. Paxillin is a sub-strate...
- 10
- 393
- 0
Báo cáo y học: "Differential expression of interferon-induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon alpha" potx
... 48:1330-1333.doi:10.1186/1743-422X-7-311Cite this article as: Scagnolari et al.: Differential expression of interferon- induced microRNAs in patients with chronic hepatitis C virus infection treated with pegylated interferon ... Virology Journal 2010, 7:311http://www.virologyj.com/content/7/1/311Page 9 of 9RESEARC H Open AccessDifferential expression of interferon- induced microRNAs in patients with chronic hepatitis C virus infection ... impor-tance of miRNAs in defending the host against virus infections, it is possible that IFN-induced miRNAs mayrepresent an important determinant of the clinical outcome of IFN therapy in HCV infection. IntroductionMicroRNAs...
- 9
- 336
- 0
Báo cáo y học: " Differential expression of Toll-like receptors on human alveolar macrophages and autologous peripheral monocytes" pdf
... Inc.).Cells were stimulated with 1 ng/mL synthetic lipoproteinPal mitylated N-acyl-S-diacylglyceryl Cystein e (Pam3Cys)(EMC Microcollections, Tübingen, Germany), 100 ng/mL LPS from Escherichia coli ... negative (n =7) subjects.TLR ligands induce production of pro-inflammatorycytokines by bronchoalveolar cells and monocytesTo assess the cytokine-inducing functional capability of TLR2, TLR4 and ... ocytes. This finding maysuggest expression of non-functional cell surface TLR9,while the comparable induction of cytokine production in both cell types suggests that intracellular TLR9 maybe...
- 13
- 251
- 0
Báo cáo y học: "Differential expression of copper-associated and oxidative stress related proteins in a new variant of copper toxicosis in Doberman pinscher" potx
... small intracellular protein capable of chelating severalmetal ions, including copper. It contains many cysteineresidues, which allow binding and storage of copper. Fur-thermore, MT1A is inducible, ... trafficking in hepatocytes. Copper uptake is mediated by the receptor CTR1. In the cell, copper can bind to copper chaperones such as CCS, COX17, and ATOX1 which in turn deploy to SOD1, the mitochondrial ... differentially expressed genes within atarget panel, investigating different groups ranging from copper-associated subclinical hepatitis (CASH) to a clinical chronic hepatitis with high hepatic copper concentrations...
- 13
- 300
- 0
Báo cáo y học: ": Differential splicing of the apoptosis-associated speck like protein containing a caspase recruitment domain (ASC) regulates inflammasomes" doc
... 5'-GCCATCCTGGATGCGCTG-GAG-3', 5'-GGCCGCCTGCAGCTTGAAC-3' (ASC -c: 66 bp); pr-3: 5'-CTGACCGCCGAGGAGCTCAA-GAAGT-3', 5'-GGCGCCGTAGGTCTCCAGGTA-GAAG-3' (ASC and ASC-b: ... truncatedASC isoforms, ASC-b and ASC -c, could impair theinflammasome adaptor function of ASC. Co -expression of ASC with ASC-b resulted in the co-localization of bothproteins in the perinuclear ... ASC-d exhibit differences in their ability to co-localize with other inflammasome componentsASC functions as an adaptor by interacting with NLRPsby PYD-PYD and with caspase 1 by CARD-CARD inter-action,...
- 13
- 231
- 0
Báo cáo y học: "Differential expression, function and response to inflammatory stimuli of 11β-hydroxysteroid dehydrogenase type 1 in human fibroblasts: a mechanism for tissue-specific regulation of inflammation" pps
... TGGACAAGAACAGCAACGAGReverse primer: TTGTCACTGGTCAGCTCCAGProbe: CACCTTCTGCTGCGTCTCCACGTT C/ EBPβ Forward primer: GACAAGCACAGCGACGAGTAReverse primer: GTGCTGCGTCTCCAGGTTProbe: ATCTTGGCCTTGTCGCGGCTCTTIL-6 ... CATGCTCATTCTCAACCACATCACCAACAH6PDH Forward primer: CAGGTGTCCTAGTGCACATTGACReverse primer: GTAGCCCACTCTCTCGTCCAAProbe: AAGGCACGCCCTCCCAGCGGRα Forward primer: GCGATGGTCTCAGAAACCAAACReverse primer: GAGATTACAGAGGAAGTTATCCTCTGCProbe: ... = CCAAT/enhancer binding protein; Ct = the cycle number at which logarithmic PCR plots cross a calculated threshold line; ELISA = enzyme-linked immunosorbent assay; GR = glucocorticoid receptor;...
- 10
- 438
- 0
Từ khóa: báo cáo y họcbáo cáo y học cổ truyềnmẫu báo cáo y học cổ truyềnbao cao y hoc colchicinphan ban luan trong bao cao y hoc co truyenrecommendations for prevention and control of hepatitis c virus infectionprogress toward prevention and control of hepatitis c virus infectionprevention of hepatitis c virus infectionadjuvant online7f to support estimations of individual prognosis and the absolute benefit of adjuvant treatment for patients with early invasive breast cancerbáo cáo khoa học y họcbáo cáo y tế học đườngmẫu báo cáo y tế học đườngbáo cáo y tế học đường cuối nămbáo cáo y tế học đường năm 2012báo cáo y tế học đường trường mầm nonMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Nghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngChuong 2 nhận dạng rui roKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)QUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ