báo cáo khoa học:" Predictors of mortality and short-term physical and cognitive dependence in critically ill persons 75 years and older: a prospective cohort study" ppt
... the clinical impact of an ICU stay on physical and cognitive depen- dence and subjective health status in survivors. Materials and methods Setting and Patients This prospective observational cohort ... 70 years and older with abdominal pathologies and in mixed medical- surgical populations 80 years and older admitted to the ICU. In contrast, dialysis was not...
Ngày tải lên: 12/08/2014, 01:22
... several studies have investigated the efficacy of INF-γ as an adjuvant against pathogens [10,22, 32]. Duck INF-γ used as an adjuvant increased the protective efficacy of a DNA vaccine against ... Weining KC, Staeheli P, Zhu JJ. Adjuvant effects of IL-1beta, IL-2, IL-8, IL-15, IFN-alpha, IFN-gamma TGF-beta4 and lymphotactin on DNA vaccination against Eimeria acervulina. Vaccine...
Ngày tải lên: 07/08/2014, 23:22
... 5'- caccttcCCTTTCCCACAGATAAGAAGG5G'-3' Reverse Sequence: 5'-CAATGGGCTGGGAAGAATTAACA- 3'. The PCR product size was 66 bp. Histological cuts One lobe of the thyroid gland of each rat was obtained and ... DNA extrac- tion. NAC: carried out organ extraction and participated in the DNA extraction and in the real time PCR. AD: per- formed the statistical analy...
Ngày tải lên: 11/08/2014, 08:20
Báo cáo y học: "Performance of N-terminal-pro-B-type natriuretic peptide in critically ill patients: a prospective observational cohort study" pps
... concept and design, acquisition of data, analysis and interpretation of data, drafting of the manu- script, and critical revision of the manuscript for important intellectual content and had full access ... to all of the data in the study and takes responsibility for the integrity of the data and the accuracy of the data analysis. J-PQ participated in study conce...
Ngày tải lên: 13/08/2014, 11:23
Báo cáo y học: "Impact of emergency intubation on central venous oxygen saturation in critically ill patients: a multicenter observational study" potx
... - ScvO 2 )/SaO 2 , where SaO 2 is arterial oxygen saturation. The clinical characteristics of the patients, demographic varia- bles, cause of intubation, use of vasoactive drugs, and severity scores (Acute ... participated in its design and coor- dination and helped to draft the manuscript. RC (Ricardo Cas- tro) conceived of the study, and participated in its design and...
Ngày tải lên: 13/08/2014, 16:20
Báo cáo khoa học: Cause of mortality in insects under severe stress Hitoshi Matsumoto, Kohjiro Tanaka, Hirofumi Noguchi and Yoichi Hayakawa pdf
... neurilemma of MPLI-injected larva is thinner (indicated with bars shown in A and B) and less dense (indicated with stars as shown in C and D) than that of control BSA- injected larva. Further, a gap ... times more abundant than that observed in control larvae. Structural changes in MPLI-treated larval brains The dopamine in ux into the MPLI-injected larval brain suggest...
Ngày tải lên: 23/03/2014, 21:20
báo cáo khoa học: " Predictors of HIV infection and prevalence for syphilis infection among injection drug users in China: Community-based surveys along major drug trafficking routes" pps
... tests, and were an active part of the preparation of the manuscript. SHV provided input with guidance on the data analysis and interpretation, and co-wrote the manuscript. All authors read and approved ... in mainland China, as well as Hong Kong, Macao, and Tai- wan, had reported cases of HIV/AIDS among drug users from 1989 to 2004. Yunnan reported the highest number of an...
Ngày tải lên: 11/08/2014, 18:20
báo cáo khoa học:" Predictors of health status do not change over three-year periods and exacerbation makes difference in Chronic Obstructive Pulmonary Disease" ppsx
... study. Statistical analysis All data were analyzed using SigmaStat 3.2 (Inc, Chicago, IL, USA) and STATA 10.0 (Stata Corp, Texas, USA). Mean ± SD or median interquartile range (25- 75% ) was used ... variable. This analysis was done separately for all patients evaluated at baseline and for those followed during three years. After three years, we included the final values of...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo khoa học: Structure of the atrial natriuretic peptide receptor extracellular domain in the unbound and hormone-bound states by single-particle electron microscopy ppt
... transmembrane domain, and an intracellular domain consisting of an ATP-binding regulatory domain and a GCase catalytic domain [8]. ANP binding to the ECD stimulates the intracellular GCase domain, ... possesses intrinsic guanylate cyclase (GCase) activity. The ANP receptor occurs as a homodimer of a single-transmembrane polypeptide, each containing an extracellular ANP- binding...
Ngày tải lên: 07/03/2014, 03:20
Báo cáo khoa học: Analyses of co-operative transitions inPlasmodium falciparumb-ketoacyl acyl carrier protein reductase upon co-factor and acyl carrier protein binding pdf
... were 5¢-CATG CCATGGGAAAAGTTGCTTTA GTAACAGGTGCAGGA-3¢ (NcoI site underlined) and 5¢-CCG CTCGAGAGGTGATAGTCCACCGTCTATTACG AAAACTCG-3¢ (XhoI site underlined) using PlatinumÒ Pfx DNA polymerase (Invitrogen, ... drugs, such as chloroquine, is growing at an alarming rate and the increasing bur- den of malaria caused by drug-resistant parasites has led investigators to seek novel antimalarial d...
Ngày tải lên: 23/03/2014, 10:21