... identity with the BAS1 protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF 9 of A. thaliana. These proteins b elong to the 2Cys-Prx subfamily. A ll plan t 2Cys-Prx proteins, ... were separated by HPLC and some of them were totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2). Computer database searches base...
Ngày tải lên: 08/03/2014, 16:20
... polyacrylamide gels. Antibody staining of sections from bovine prelactating and lactating mammary gland using monoclonal and polyclonal antibodies has shown that PAS III is largely concentrated ... + d + Lung c –+ d ND Lymph node c –+ d ND a Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTT...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: " Isolation and characterization of a virus (CvV-BW1) that infects symbiotic algae of Paramecium bursaria in Lake Biwa, Japan" pptx
... 7:222 http://www.virologyj.com/content/7/1/222 Page 7 of 10 RESEARC H Open Access Isolation and characterization of a virus (CvV-BW1) that infects symbiotic algae of Paramecium bursaria in Lake Biwa, Japan Ryo Hoshina 1,2 , ... an environmental study of viruses infecting the symbiotic single-celled algae of Paramecium bursaria (Paramecium bu...
Ngày tải lên: 12/08/2014, 01:21
Báo cáo y học: "Isolation and characterization of microparticles in sputum from cystic fibrosis patients" pot
... (ARDS) and hydrostatic pulmonary oedema. Intra-alveolar MPs from ARDS patients contain high levels of tissue factor, show an highly procoagulant activity, and are likely contribute to intra-alveolar ... Spu- tum samples were directly spread-out in selective media, such as MacConkey agar for Pseudomonas aeruginosa and Alcaligenes xilosoxidans, manitol salt agar for Staph- ylococcus a...
Ngày tải lên: 12/08/2014, 11:22
Báo cáo y học: "Isolation and characterization of human cells resistant to retrovirus infection" pdf
... the parental and mutant cells. To examine if the defect in infection was in the early stages of the life-cycle we next examined the extent of integration of HIV-1 DNA after infection of parental and ... prepared as out- lined above. 500 ng of DNA was used as a template to amplify full product by real-time quantitative PCR as out- lined above. Nuclear and Cytoplasmic sepa...
Ngày tải lên: 13/08/2014, 05:22
Tài liệu Báo cáo khoa học: Isolation and characterization of four type 2 ribosome inactivating pulchellin isoforms from Abrus pulchellus seeds docx
... these residues are retained in positions corresponding exactly to those in the A- chains of ricin and abrin [26]. Over- all, it is therefore unlikely that the A- chains differ sig- nificantly in catalytic activity. The ... R, Terenzi A, Pasqualucci L, Falini B & Stirpe F (1998) Evaluation of immunotoxins containing single-chain ribosome-inactivating proteins and an ati C...
Ngày tải lên: 18/02/2014, 16:20
Tài liệu Báo cáo Y học: Expression and characterization of active site mutants of hevamine, a chitinase from the rubber tree Hevea brasiliensis docx
... strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense ... strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-...
Ngày tải lên: 22/02/2014, 04:20
Báo cáo khoa học: Isolation and characterization of a D-cysteine desulfhydrase protein from Arabidopsis thaliana pptx
... reveal any activity in this assay. The protein was also tested for b-cyanoalanine synthase activity by using d-cysteine and cyanide as substrates; the d-CDes protein did not show any b-cyanoalanine ... coenzyme. Enzymes of the b-family catalyse mainly b-replacement or b-elimination reac- tions. The d-alanine aminotransferase and the alanine racemase family are the other two independen...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Isolation and characterization of an IgNAR variable domain specific for the human mitochondrial translocase receptor Tom70 potx
... 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using ... disulphide minus variant of 12F-11 incorporating mutations Cys22Ala and Cys82Val was constructed by overlapping PCR using oligonucleotide primers N851...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Expression and characterization of recombinant vitamin K-dependent c-glutamyl carboxylase from an invertebrate, Conus textile doc
... carboxylase and recombinant bovine carboxylase (Table 3). In addition, the activity of mammalian carboxylases operating on nonpropeptide-con- taining substrates such as FLEEL is stimulated by ... N-terminal amino acids of the Conus carboxylase are dominated by acidic residues including three aspartate residues and a glutamate-rich region that includes stretches of three and...
Ngày tải lên: 17/03/2014, 10:20