Báo cáo y học: " Isolation and characterization of a virus (CvV-BW1) that infects symbiotic algae of Paramecium bursaria in Lake Biwa, Japan" pptx

... identity with the BAS1 protein of Brassica, spinach, barley and A. thaliana,PR1ofPhaseolus and MHF 9 of A. thaliana. These proteins b elong to the 2Cys-Prx subfamily. A ll plan t 2Cys-Prx proteins, ... were separated by HPLC and some of them were totally or partially analyzed by Edman sequencing and/ or by MALDI-TOF mass spectrometry ( Fig. 2). Computer database searches base...

Ngày tải lên: 08/03/2014, 16:20

... polyacrylamide gels. Antibody staining of sections from bovine prelactating and lactating mammary gland using monoclonal and polyclonal antibodies has shown that PAS III is largely concentrated ... + d + Lung c –+ d ND Lymph node c –+ d ND a Primer pair: 5¢-AATACCAAAGAAGCCTACAATG-3¢ and 5¢-GTACGAAGTGGAGGTATGTCATC-3¢. b Primer pair: 5¢-GCCATTT TAGGTGCTATTCTGG-3¢ and 5¢-TATTTTCTTT...

Ngày tải lên: 24/03/2014, 04:21

... 7:222 http://www.virologyj.com/content/7/1/222 Page 7 of 10 RESEARC H Open Access Isolation and characterization of a virus (CvV-BW1) that infects symbiotic algae of Paramecium bursaria in Lake Biwa, Japan Ryo Hoshina 1,2 , ... an environmental study of viruses infecting the symbiotic single-celled algae of Paramecium bursaria (Paramecium bu...

Ngày tải lên: 12/08/2014, 01:21

... (ARDS) and hydrostatic pulmonary oedema. Intra-alveolar MPs from ARDS patients contain high levels of tissue factor, show an highly procoagulant activity, and are likely contribute to intra-alveolar ... Spu- tum samples were directly spread-out in selective media, such as MacConkey agar for Pseudomonas aeruginosa and Alcaligenes xilosoxidans, manitol salt agar for Staph- ylococcus a...

Ngày tải lên: 12/08/2014, 11:22

... the parental and mutant cells. To examine if the defect in infection was in the early stages of the life-cycle we next examined the extent of integration of HIV-1 DNA after infection of parental and ... prepared as out- lined above. 500 ng of DNA was used as a template to amplify full product by real-time quantitative PCR as out- lined above. Nuclear and Cytoplasmic sepa...

Ngày tải lên: 13/08/2014, 05:22

... these residues are retained in positions corresponding exactly to those in the A- chains of ricin and abrin [26]. Over- all, it is therefore unlikely that the A- chains differ sig- nificantly in catalytic activity. The ... R, Terenzi A, Pasqualucci L, Falini B & Stirpe F (1998) Evaluation of immunotoxins containing single-chain ribosome-inactivating proteins and an ati C...

Ngày tải lên: 18/02/2014, 16:20

... strand 5¢-TTGGATGGTATTGATTTTAACATAGAGCATGGTTCAACC-3¢ Anti-sense strand 5¢-GGTTGAACCATGCTCTATGTTAAAATCAATACCATCCAA-3¢ Glu127Ala Sense strand 5¢-GGTATTGATTTTGACATAGCGCTATGTCAAAATCAATACC-3¢ Anti-sense ... strand 5¢-GTACAGGGTTGAACCATGCGCTATGTCAAAATCAATACC-3¢ Asp125Ala/Glu127Ala Sense strand 5¢-GATGGTATTGATTTTGCCATAGCGCATGGTTCAACCCTG-3¢ Anti-sense strand 5¢-CAGGGTTGAACCATGCGCTATGGCAAAATCAATACCATC-...

Ngày tải lên: 22/02/2014, 04:20

... reveal any activity in this assay. The protein was also tested for b-cyanoalanine synthase activity by using d-cysteine and cyanide as substrates; the d-CDes protein did not show any b-cyanoalanine ... coenzyme. Enzymes of the b-family catalyse mainly b-replacement or b-elimination reac- tions. The d-alanine aminotransferase and the alanine racemase family are the other two independen...

Ngày tải lên: 16/03/2014, 18:20

... 5¢-ACAAGGG TAGACCAAACACCAAGAACAGCAACAAAAGAG ACGGGCGAATCACTGACCATCAACgccGTCCTGA GAGAT-3¢) and N8518 (Reverse: 5¢-TTTCACGGTTAA TGCGGTGCCAGCTCCCCAACTGTAATAAATACC AGACAAATTATATGCTCCaacCCTATACGTGCCA CTG-3¢); followed by secondary PCR using ... disulphide minus variant of 12F-11 incorporating mutations Cys22Ala and Cys82Val was constructed by overlapping PCR using oligonucleotide primers N851...

Ngày tải lên: 17/03/2014, 10:20

... carboxylase and recombinant bovine carboxylase (Table 3). In addition, the activity of mammalian carboxylases operating on nonpropeptide-con- taining substrates such as FLEEL is stimulated by ... N-terminal amino acids of the Conus carboxylase are dominated by acidic residues including three aspartate residues and a glutamate-rich region that includes stretches of three and...

Ngày tải lên: 17/03/2014, 10:20