báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

báo cáo khoa học:" Histological analysis of the effects of a static magnetic field on bone healing process in rat femurs" pptx

... is able to affect the bone healing process; 2. The comparison of test and control groups indicates that bone healing was accelerated by the effect of mag- netic fields in all the conditions analyzed; 3. ... predominantly hori- zontal and flat direction maintained continuity and shape of the remaining cortical levels. Trabecular proliferation was also apparent in...

Ngày tải lên: 11/08/2014, 23:22

9 361 0
Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

Báo cáo khoa học: Proteome analysis at the level of subcellular structures Mathias Dreger pot

... upregulation of a number of Golgi proteins in Golgi preparations from rat mammary gland cells in the state of maximal secretion at lactation as compared to that in a state of basal secretion. This ... the maturation of the organelle was monitored by comparative analysis of phagosomes in different stages. The authors demonstrated that the phagosomes acquir...

Ngày tải lên: 23/03/2014, 20:22

11 493 0
báo cáo khoa học: " Pilot study evaluating the effects of an intervention to enhance culturally appropriate hypertension education among healthcare providers in a primary care setting" pdf

báo cáo khoa học: " Pilot study evaluating the effects of an intervention to enhance culturally appropriate hypertension education among healthcare providers in a primary care setting" pdf

... because almost all of them had completed a some- what similar training, organised by the PCHCs at an ear- lier stage. After the training, the tools for CAHE were made available on paper to the healthcare ... between the interven- tion and control groups. Table 4 shows the mean scores of the respondents of the intervention and control groups and the results of th...

Ngày tải lên: 10/08/2014, 10:22

10 441 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... of immunoreactivity in the latter strain was due to the inability of the truncated protein to insert into and be stable in the inner mitochondrial membrane or lack of detection of the truncated protein ... 1211 Interestingly, the absence of subunit 6 also resulted in an increase in the ratio of intermediate to mature cyto- chrome c 1 and a disappearance of...

Ngày tải lên: 19/02/2014, 12:20

10 518 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 ... in about 252 1A BC 5′ 3′ 5′ 3′ 5′ 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CC...

Ngày tải lên: 18/02/2014, 04:20

9 541 0
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

... relevant to the regulation of AC proteins. In view of the important and antagonistic effects of ADF ⁄ cofilin and phosphate on actin dynamics, we examined here the binding of cofilin to F-actin and ... of subdomain 2, while phosphate has a stabilizing effect on F-actin structure. The antagonistic effects of Pi and AC proteins on F-actin are also indicated by in...

Ngày tải lên: 19/02/2014, 07:20

9 488 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

... adaptations in the eye in the human lineage. In addition to the evolution of cN and cS crystal- lins, even more specialization in the c-crystallins has occurred with the loss of the N-terminal ... USA). All use of animals complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the Intramural Animal Care and Use program...

Ngày tải lên: 19/02/2014, 17:20

16 561 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... gene expression was absent in cells with a functional inactive HIF or lacking the HIF- 1a protein in general. In fact, for the P4ha1I the involvement of HIF in the activation of gene expression during ... revealed a characteristic time-dependent increase of the mRNA abun- dance in A7 r5 cells incubated at 1% oxygen for P4ha1 and P4ha2, starting around 4 h of...

Ngày tải lên: 20/02/2014, 02:21

8 434 0
Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

Tài liệu Báo cáo khoa học: Multidentate pyridinones inhibit the metabolism of nontransferrin-bound iron by hepatocytes and hepatoma cells docx

... chelators suggesting that the chelators may act intracellularly as well as at the cell membrane. In conclusion (a) rat hepatocytes have a much greater capacity to take up NTBI than the rat hep- atoma cell line ... an abnormally high absorption of Fe leading to saturation of the plasma Tf. Patients with the hereditary anemia thalassemia [4,5] also have increased plasma Fe...

Ngày tải lên: 20/02/2014, 11:20

10 545 0
Tài liệu Báo cáo khoa học: "Detecting Novel Compounds: The Role of Distributional Evidence" potx

Tài liệu Báo cáo khoa học: "Detecting Novel Compounds: The Role of Distributional Evidence" potx

... 1997. Integrating sym- bolic and statistical representations: The lexicon pragmat- ics interface. In Proceedings of the 35th Annual Meeting of the Association for Computational Linguistics and ... Natural Language Processing. The MIT Press, Cambridge, MA. Elaine Marsh. 1984. A computational analysis of complex noun phrases in navy messages. In Proceedings of the...

Ngày tải lên: 22/02/2014, 02:20

8 583 0
w