báo cáo khoa học:" Numerical simulation of in vivo intraosseous torsional failure of a hollow-screw oral implant" pdf

... Access Research Numerical simulation of in vivo intraosseous torsional failure of a hollow-screw oral implant Murat Cehreli* 1 , Murat Akkocaoglu 2 and Kivanc Akca 3 Address: 1 Associate Professor of Prosthodontics, ... implant healing and main- tenance of bone-implant interface, early and late implant failures are still reported. At present, commonly cited fac-...

Ngày tải lên: 11/08/2014, 23:22

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... Purification and characterization of a transmembrane domain-deleted form of lecithin retinol acyltransferase. Biochemistry 42, 6090–6098. 45 Muniz A, Vi...

Ngày tải lên: 14/02/2014, 14:20

... X-linked agammaglobulin- emia. A clinical and molecular analysis. Medicine (Baltimore) 75, 287–299. 27 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini ... Hussain 1,2, *, Liang Yu 1,3, *, Rani Faryal 1,2 , Dara K. Mohammad 1 , Abdalla J. Mohamed 1,4 and C. I. Edvard Smith 1 1 Clinical Research Center, Department of Laboratory Medicine, Karolinska...

Ngày tải lên: 14/02/2014, 18:20

... compilation ª 2006 FEBS and alkali extraction might not always be a reliable indicator of whether a protein is integral in the outer membrane [17,20–22]. As a distinct means to separate integral and ... Osanai K, Takahashi K, Nakamura K, Takahashi M, Ishigaki M, Sakuma T, Toga H, Suzuki T & Voelker DR (2005) Expression and characterization of Rab38, a new member of the Rab...

Ngày tải lên: 19/02/2014, 07:20

... some of which are (a) nasals in Tamil (Shanmugam, 1972) and Malayalam (Shanmugam, 1972; Ladefoged and Maddieson, 1996), (b) laterals in Albanian (Lade- foged and Maddieson, 1996), and (c) stops in ... inventories: A complex network ap- proach. In COLING-08, pages 601–608. J. R. Quinlan. 1993. C4.5: Programs for Machine Learning. Morgan Kaufmann. S. V. Shanmugam. 1972. Dental and a...

Ngày tải lên: 22/02/2014, 02:20

... the N-terminal domain, the comparable overall trypto- phan exposure in the mutants compared with the wild-type protein indicates that the structure of the N-terminal domain is maintained, at least in ... at a molar ratio of 0.5 : 1.0 Hsp25 : insulin (Fig. 7), with all mutants showing comparable suppression of insulin precipitation at this ratio. All of the glutamic acid residue...

Ngày tải lên: 07/03/2014, 04:20

... vitro activity assay for HylP2 was performed using HA as substrate and ascorbic acid as an inhibitor. The activity of the enzyme was determined by measuring its ability to breakdown HA to unsaturated ... lactose Parul Mishra 1, *, R. Prem Kumar 2, *, Abdul S. Ethayathulla 2 , Nagendra Singh 2 , Sujata Sharma 2 , Markus Perbandt 3 , Christian Betzel 3 , Punit Kaur 2 , Alagiri Srinivasan 2 ,...

Ngày tải lên: 23/03/2014, 04:21

... using a human hippocampal cDNA library, a different PDZ domain- containing protein was found to interact with serine racemase, also requiring the C-terminal binding motif [30]. Protein interacting ... The finding of serine racemase interacting with the PDZ6 domain of GRIP and being activated was the first report on cellular interaction partners of serine race- mase and it raised sever...

Ngày tải lên: 30/03/2014, 04:20

... thus individual trees were used as observations in all statistical analyses. The aver- age of 8.5 annual rings with an average cambial age of 25 years was included in the ... of data. The normal way to present this data is to calculate mean values for indi- vidual annual rings, as in figure 1. However, in statistical evaluation using...

Ngày tải lên: 08/08/2014, 14:21

... pine stands of mountainous Mediterranean climate area Ignacio Santa Regina a Teresa Tarazona b a IRNA-C.S.I.C., Cordel de Merinas 40, Apdo. 257, 37071 Salamanca, Spain b J. ... weather station at Pradoluengo, near the experi- mental plots, at an altitude of 960 m, has an annual mean temperature of 12.4 °C, the average of the minima and m...

Ngày tải lên: 08/08/2014, 14:21