báo cáo khoa học:" Tissue engineering: a challenge of today''''''''s medicine" potx

... research papers, pub- lished in a wide array of (material-, biological-, biomedical-, biophysical-, and clinical-based) journals, covering all aspects of basic research, preclinical testing and ... therefore as a thematically broad ranged journal, including all disciplines involved in the head and neck area. We hope this journal will attract basic researchers and clinicians who are in...

Ngày tải lên: 11/08/2014, 23:22

... Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into the EcoRV site of ... that mammalian Gup1, a mem- ber of the MBOAT superfamily bearing sequence simi- larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports have demo...

Ngày tải lên: 18/02/2014, 16:20

... Haji ˇ c, Massimiliano Ciaramita, Richard Johans- son, Daisuke Kawahara, Maria Ant ` onia Mart ´ ı, Llu ´ ıs M ` arquez, Adam Meyers, Joakim Nivre, Sebastian Pad ´ o, Jan ˇ St ˇ ep ´ anek, Pavel ... annotated instances. In contrast, our study focused on a se- lect group of nominal predicates, each associated with a large number of annotated instances. 3 Data annotation and analysis 3....

Ngày tải lên: 17/03/2014, 00:20

... service takes a Portuguese nomi- nal form — a form of a noun or an adjective, in- cluding adjectival forms of past participles –, to- gether with a bundle of inflectional feature values — values of ... The name- based component is built upon HMMs with the help of TnT (Brants, 2000). It was trained over a manually annotated corpus of approximately 208,000 words, and evalua...

Ngày tải lên: 17/03/2014, 02:20

... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT Vps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC YEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAG IRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGG Table 3. Pla...

Ngày tải lên: 23/03/2014, 09:20

... (pNPa GlcNAc), a- d-xyl opyranose (pNPaXyl), a- d-manno- pyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNP aAraf) and a- l-rhamnopyra- nose (pNPaRha) (less than 10 lm pNP liberated ... trehalose, turanose, raffi- nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc, pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRha and pNPaXyl were purchased from Sigma (St. Louis, MO, USA...

Ngày tải lên: 29/03/2014, 21:20

... chunking can be used to improve performance for a dialogue act tagger that uses a case-based reasoning approach. 1 Dialogue act tagging A dialogue act (hereafter DA) is an encapsulation of the speakerÕs ... the DA tags are unknown. 6 Acknowledgements This work was supported by an Australian Post- graduate Award. Thanks to Cara MacNish and Shelly Harrison for supervision and advice. Ma...

Ngày tải lên: 31/03/2014, 03:20

... can motivate a speaker to use a variant in place of a canonical form (Glucksberg, 1993). Nevertheless, lexical and syntactic flexibility may well be used as partial indicators of semantic ana- lyzability, ... the beans has an idiomatic meaning (“to reveal a secret”), while spill the peas and spread the beans have only literal interpretations. Idiomatic combinations are also syntact...

Ngày tải lên: 31/03/2014, 20:20

... the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas the labia ... complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mass...

Ngày tải lên: 10/08/2014, 22:20

... Access Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases Joana Gomes * , Ana Antunes, Aurora Carvalho and Raquel Duarte Abstract Introduction: Esophageal involvement ... growth as esophageal polyps may also be present as in case two [5,11]. Esophageal carcinoma is part of the differential diagnosis as was the case for both our patients. Diagnosis is usua...

Ngày tải lên: 10/08/2014, 23:20