báo cáo khoa học:" Tissue engineering: a challenge of today''''''''s medicine" potx
báo cáo khoa học:" Tissue engineering: a challenge of today''''s medicine" potx
... research papers, pub-lished in a wide array of (material-, biological-,biomedical-, biophysical-, and clinical-based) journals,covering all aspects of basic research, preclinical testingand ... therefore as a thematically broad rangedjournal, including all disciplines involved in the head and neck area. We hope this journal will attractbasic researchers and clinicians who are involved ... the future. The artificial generation of hard and soft tissues offers clinicians new tools in thetreatment of various diseases of the head and face region.On the other hand, tissue engineering...
- 2
- 191
- 0
Tài liệu Báo cáo khoa học: Mammalian Gup1, a homolog of Saccharomyces cerevisiae glycerol uptake/transporter 1, acts as a negative regulator for N-terminal palmitoylation of Sonic hedgehog doc
... Taq DNA polymerase(Promega, Madison, WT, USA) using the primers5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG-3¢. The cDNA was subcloned into the EcoRV site of ... that mammalian Gup1, a mem-ber of the MBOAT superfamily bearing sequence simi-larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports havedemonstrated ... primers 5¢-CCTGCAGCAGCGGCAGGCAAGGTTATATAG-3¢ and 5¢-GGGCCCAGAGGCCAGGCCGGGGCACACCAG-3¢, and primers 5¢-GGCATGCTGGCTCGCCTGGCTGTGGAAGCA-3¢ and 5¢-GGATCCTGGGAAAGCGCCGCCGGATTTGGC-3¢, respec-tively....
- 14
- 499
- 0
Báo cáo khoa học: "Beyond NomBank: A Study of Implicit Arguments for Nominal Predicates" doc
... Hajiˇc, Massimiliano Ciaramita, Richard Johans-son, Daisuke Kawahara, Maria Ant`onia Mart´ı, Llu´ısM`arquez, Adam Meyers, Joakim Nivre, SebastianPad´o, JanˇStˇep´anek, Pavel ... annotatedinstances. In contrast, our study focused on a se-lect group of nominal predicates, each associatedwith a large number of annotated instances.3 Data annotation and analysis3.1 Data annotationImplicit ... Deepak Ravichandran. 2004.Automatically labeling semantic classes. InDaniel Marcu Susan Dumais and Salim Roukos, ed-itors, HLT-NAACL 2004: Main Proceedings, pages321–328, Boston, Massachusetts,...
- 10
- 402
- 0
Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf
... service takes a Portuguese nomi-nal form — a form of a noun or an adjective, in-cluding adjectival forms of past participles –, to-gether with a bundle of inflectional feature values— values of ... The name-based component is built upon HMMs with thehelp of TnT (Brants, 2000). It was trained over a manually annotated corpus of approximately208,000 words, and evaluated against an unseenportion ... is a web center of online lin-guistic services aimed at both demonstrat-ing a range of language technology toolsand at fostering the education, researchand development in natural language...
- 4
- 299
- 0
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATTVps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAGVps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATCYEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGGYEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA ... CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAGIRA F CCTAAGTCGAAGGATTTGAAGCACTTGGAAAGTGAAGIRA R CTTCACTTTCCAAGTGCTTCAAATCCTTCGACTTAGGTable 3. Plasmids used in this study.Plasmid Description SourceYCplac111 CEN4 ARS1 ... Fujita H, Yamanaka M, Imamura K, Tanaka Y, Nara A, Yoshimori T, Yokota S & Himeno M (2003) A dominant negative form of the AAA ATPaseSKD1 ⁄ VPS4 impairs membrane trafficking out of endo-somal...
- 14
- 362
- 0
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc
... (pNPaGlcNAc), a- d-xyl opyranose (pNPaXyl), a- d-manno-pyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNP aAraf) and a- l-rhamnopyra-nose (pNPaRha) (less than 10 lm pNP liberated ... trehalose, turanose, raffi-nose, pNPaAra, pNPaAraf, pNPaGal, pNPaGalNAc,pNPbGal, pNPaGlc, pNPaGlcNAc, pNPaMan, pNPaRhaand pNPaXyl were purchased from Sigma (St. Louis, MO,USA). Galactomannans ... andsuperimposition of an equilibrium mixture of a- andb-galactose from Oryza sativa a- galactosidase [28],N-acetyl -a- galactosamine from Gallus gallus a- N-acet-ylgalactosaminidase [29] and melibiose from human a- galactosidase...
- 14
- 579
- 0
Báo cáo khoa học: "Discourse chunking: a tool in dialogue act tagging" potx
... chunking canbe used to improve performance for a dialogue act tagger that uses a case-basedreasoning approach.1 Dialogue act tagging A dialogue act (hereafter DA) is an encapsulation of the speakerÕs ... the DA tags areunknown.6 AcknowledgementsThis work was supported by an Australian Post-graduate Award. Thanks to Cara MacNish andShelly Harrison for supervision and advice. Manythanks to ... such as ÒokayÓ or ÒyeahÓare particularly problematic in this kind of taskbecause they have rather general semantic contentand they are commonly used in a wide range of contexts. The word ÒyeahÓ...
- 6
- 196
- 0
Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx
... can motivate a speaker to use a variantin place of a canonical form (Glucksberg, 1993).Nevertheless, lexical and syntactic flexibility maywell be used as partial indicators of semantic ana-lyzability, ... the beans has an idiomatic meaning (“toreveal a secret”), while spill the peas and spreadthe beans have only literal interpretations.Idiomatic combinations are also syntacticallypeculiar: most ... simply take the mostdominant pattern as the canonical one. Instead, wecalculate a -score for the target pair andeach pattern :in which is the mean and the standard deviationover the sample...
- 8
- 295
- 0
báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx
... the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, whereas the labia ... complications of this presentation are infections of the urinary tract and retention of urine in the vagina. We present the case of a post-menopausal woman with adnexal mass and abdominal pain ... the article as it appeared upon acceptance. Fully formattedPDF and full text (HTML) versions will be made available soon.Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a...
- 14
- 367
- 0
báo cáo khoa học: "Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases" pps
... AccessDysphagia as a manifestation of esophagealtuberculosis: a report of two casesJoana Gomes*, Ana Antunes, Aurora Carvalho and Raquel DuarteAbstractIntroduction: Esophageal involvement ... growth as esophageal polyps may also bepresent as in case two [5,11]. Esophageal carcinoma ispart of the differential diagnosis as was the case for bothour patients. Diagnosis is usually made ... ethambutol [12,13]. Surgical treatment is reservedfor complications such as esophageal, tracheoesopha-geal and aortoesophageal fistulas, the latter of whichcan lead to death by massive hematemesis...
- 5
- 355
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpbáo cáo khoa học thủy sảnBáo cáo thực tập tại nhà thuốc tại Thành phố Hồ Chí Minh năm 2018Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếThơ nôm tứ tuyệt trào phúng hồ xuân hươngThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíKiểm sát việc giải quyết tố giác, tin báo về tội phạm và kiến nghị khởi tố theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn tỉnh Bình Định (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀMTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ