Báo cáo y học: "An unusually large myofibroblastoma in a male breast: a case report" docx
... mimicking a malignant tumour, and its large size, much greater than any previously reported. Malignant neoplasms, such as stromal sarcoma, malignant fibrous histiocytoma and spindle-cell sarcoma, ... muscle actin, protein S-100 (a marker for tumours of neural and fat ori- gin) and epithelial marker MNF 116. Based on the his- topathology and immunocytochemistry analysis, it was diagnosed...
Ngày tải lên: 11/08/2014, 23:21
... cornea. In same way, a 9.5- mm-diameter, 300 μm flap was obtained from a donor cornea maintained in an artificial chamber (Moria Japan). The donor cornea was transported from an eye bank in the United ... Therapeutic lamellar keratoplasty with an auto- mated microkeratome. J Cataract Refract Surg 2001, 27:1161-5. 3. Saini JS, Jain AK, Sukhija J, Saroha V: Indications and outcome of...
Ngày tải lên: 11/08/2014, 10:22
... experiments of placental tissue with mAb 6A2 B2 and anti-Syncytin-1 pAb both antibodies revealed different staining patterns. Staining with anti-Syncytin-1 pAb was most prominent at the syncytiotrophoblast ... 399 :A4 0 -A4 7. 2. Komurian-Pradel F, Paranhos-Baccala G, Bedin F, Ounanian-Paraz A, Sodoyer M, Ott C, Rajoharison A, Garcia E, Mallet F, Mandrand B, Perron H: Molecular cloning and...
Ngày tải lên: 13/08/2014, 01:20
Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"
... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation...
Ngày tải lên: 31/10/2012, 16:49
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-phosphorylate...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx
... for a much larger additional GWAS, in both Europeans and non-Europeans, with clearly defined clinical criteria and at a much greater density of markers. This scale of experiment, which is proving ... Chung SA, Ferreira RC, Pant PV, Ballinger DG, Kosoy R, Demirci FY, Kamboh MI, Kao AH, Tian C, Gunnarsson I, Bengtsson AA, Rantapaa-Dahlqvist S, Petri M, Manzi S, Seldin MF, Ronnblom L, Syva...
Ngày tải lên: 09/08/2014, 14:22
Báo cáo y học: "Extra corporal membrane oxygenation in general thoracic surgery: a new single veno-venous cannulatio" potx
... participated in its coordination on the anesthesiologic and extracorporal assistance part. All authors read and approved the final manuscript. Competing interests The authors declare that they have no ... Extracorporeal oxygenation support for curative surgery in a patient with papillary thyroid carcinoma invading the trachea. J Laryngol Otol 2009, 123(7):807-10. 5. Jie Lei, Kai Su, Li...
Ngày tải lên: 10/08/2014, 09:21
Báo cáo y học: "Surgically cured hypoglycemia secondary to pleural solitary fibrous tumour: case report and update review on the Doege-Potter syndrom" pps
... et al also did not have any single case of hypoglycemia in a series of 8 cases but established that hypoglycemia was documented in 4% of the 360 cases dating before 1981 [4]. Interestingly, onset ... other hand, Shung et al in a series of 63 cases [59], De Perrot et al in a series of 15 cases [60], and Perna et al with 8 cases [61], did not report a single case of hypoglyc...
Ngày tải lên: 10/08/2014, 10:20
Báo cáo y học: " Prevalence of hallux valgus in the general population: a systematic review and metaanalysis" pdf
... Robinson J: The Aldersgate Study Bedford Park, Australia: Flinders Medical Centre 1989. 82. Saez Aldana F, Martinez Galarreta MV, Martinez-Iniguez Blasco J: Analysis of falls producing hip fracture ... 83:475-483. 65. Harris RI, Beath T: Army Foot Survey. An investigation of foot ailments in canadian soldiers Ottawa: National Research Council of Canada 1947. 66. Helfand AE: Arthritis in o...
Ngày tải lên: 10/08/2014, 21:24
Báo cáo y học: "Different fetal-neonatal outcomes in siblings born to a mother with Graves-Basedow disease after total thyroidectomy: a case series" doc
... was increased to 24 mg/3 times a day and oral administration of diazepam was necessary, because of a persistent clinical pattern of hyperthyroid- ism (tachycardia, supraventricular extrasystoles, ... tricuspid insufficiency, moderate sinusal tachycardia and low amniotic fluid. A Caesarean section was per- formed at 31 weeks of GA. A female baby was born with an Apgar score of 8-9 and...
Ngày tải lên: 11/08/2014, 11:23