báo cáo khoa học: " Needle and syringe sharing practices of injecting drug users participating in an outreach HIV prevention program in Tehran, Iran: A cross-sectional study" pps

... Japan and 5 Center for Disease Management, Ministry of Health and Medical Education, Iran Email: Mohsen Vazirian - vazirian_mohsen@yahoo.com; Bijan Nassirimanesh - bijan@ahrn.net; Saman Zamani* ... outreach HIV prevention program in Tehran, Iran: A cross-sectional study Mohsen Vazirian 1,2 , Bijan Nassirimanesh 3 , Saman Zamani* 4 , Masako Ono- Kihara 4 , Masahiro Ki...

Ngày tải lên: 11/08/2014, 20:20

... Zamani S, Ono-Kihara M, Kihara M, Ravari SM, Gouya MM: Needle and syringe sharing practices of injecting drug users participating in an outreach HIV preven- tion program in Tehran, Iran: a cross-sectional ... of needle and syringe sharing among Iranian IDUs [7-9], we here aimed to determine the prevalence and associates of needle and...

Ngày tải lên: 11/08/2014, 18:20

... antisera (Table 3). Secondary antibodies (anti-rat IgG, anti-guinea pig IgG and anti-rabbit IgG; all raised in goat and conjugated to alkaline-phosphatase; Sigma, Saint Louis, MO, USA) were used at 1 ... (X organ–sinus gland). R, retina; LG, lamina ganglionaris; ME, medulla externa; MI, medulla interna; MT, medulla terminalis. (A) General view of X organ labelled with r-anti- L and...

Ngày tải lên: 18/02/2014, 11:20

... brain and heart. Adult humans addition- ally express PDGF-C in the pancreas, adrenal gland, skeletal muscles, ovary, prostate, uterus and placenta [8,10,15,20,27,74]. PDGF-C mRNA and protein expression ... glioblastomas, medulloblastomas and fibrosis of a variety of tissues. PDGF-C appears to play an important role in Ewing family sarcomas, while PDGF-D is linked to lung, p...

Ngày tải lên: 19/02/2014, 07:20

... Nederland, Zoeterwoude, The Neth- erlands). Cell size and morphology were captured using a Leica DFC 320 digital camera and analyzed for individual cells using image analyzer software (leica qwin ... 164–171. 30 Van Dam JC, Eman MR, Frank J, Lange HC, van Dedem GWK & Heijnen JJ (2002) Analysis of glyco- lytic intermediates in Saccharomyces cerevisiae using anion exchange chromat...

Ngày tải lên: 07/03/2014, 04:20

... docking calculations Andreas G. Tzakos 1 , Patrick Fuchs 2 , Nico A. J. van Nuland 2 , Anastasios Troganis 3 , Theodore Tselios 4 , Spyros Deraos 4 , John Matsoukas 4 , Ioannis P. Gerothanassis 1 and ... absence of interactions with the s ide chains of A sp81 (in the agonist analogue) and Glu82. MD simulations of MBP(74–85), and Ala81MBP(74–85) in water and Me 2 SO To furt...

Ngày tải lên: 07/03/2014, 16:20

... [43,44]. Ca-I is co-ordinated by the side chains of Asp280 and Ser222 at the beginning and end of domain B as well as by the main-chain oxygens of Tyr315 (domain A) and Thr270 (domain B) and by two water ... co-ordinated by the side chains of Asp125, Asp146, Asn119 and Asn124, the main-chain oxygens of Gly144 and Asp121, and by a water molecule. Ca-II stabilizes a...

Ngày tải lên: 08/03/2014, 02:20

... (2006) Structural and functional analysis of PucM, a hydrolase in the ureide pathway and a member of the transthyretin-related protein family. Proc Natl Acad Sci USA 103, 9790–9795. 27 Zanotti G, ... T, Ando Y, Hata K, Kamide K, Hashimoto M, Nakamura M, Terazaki H, Yamashita T, Kai H, Hara- oka K et al. (2002) Amyloid formation in rat transthy- retin: effect of oxidative str...

Ngày tải lên: 16/03/2014, 01:20

... & Cody V (1991) Conformational analysis of lipophilic antifolates: crystal structure of 2-amino-4- oxo-6-adamantylpteridine and a comparison of its bind- ing to bacterial and avian dihydrofolate ... mutational codon underlined D31E CGAG GAGCTCACCCGGTTCAAG D31Q CGTGCCCGAG CAACTCACCCGGTTC D3 1A CGAG GCCCTCACCCGGTTCAAAG D31N GCCCGAG AACCTCACCCGGTTCAAAG D31L CGTGCCCGAG CTCCTCACCC...

Ngày tải lên: 16/03/2014, 10:20

... IV Adh) Rat CCCAGCACAGAACACCCAGCTCTCTGGATCTCAAAATGTCAGGACAGTCCG Adh4-2 Adh4 (class IV Adh) Rat CATCATCTCTGCTCTTCCAACCACCAAAGACGCAGCCCTTCCATGTCCG Adh4-3 Adh4 (class IV Adh) Rat GTGATATCAGAGAACACTGTCAGGAACAAGGCTTCAGGTCACGGTCGC Aldh1 ... Rat GGTTAACGGAGAGGCTTTGGGCACTGGGAGGCACCCCGACAATGACGCT Adh1-2 Adh1 (class I Adh) Rat TGGCCTAGAACTGCAGGAAGAGGCGTGAACAGGGATCCACTAACCGCGT Adh3 Adh3 (class III Adh)...

Ngày tải lên: 16/03/2014, 11:20