báo cáo khoa học: " Pharmacy-based needle exchange in New Zealand: a review of services" ppt

... matters related to needle exchange. The Health [Needles & Syringes] Regulations 1998 that govern the authorised sale of needles and syringes in New Zealand state that all sales of injecting equipment ... with findings in the UK [8]. A large proportion of pharmacies offered leaflets on a number of related areas such as HIV and hepatitis testing, safer injecting and saf...

Ngày tải lên: 11/08/2014, 20:20

... imaging. Arthritis Rheum 2003, 48:1374-1384. 18. Offidani A, Cellini A, Valeri G, Giovagnoni A: Subclinical joint involvement in psoriasis: magnetic resonance imaging and X- ray findings. Acta ... whom had reactive arthritis or PsA. MRI of the wrist and finger joints (metacarpophalangeal [MCP], proximal interphalangeal [PIP] and distal interphalangeal [DIP] joints) was performed using...

Ngày tải lên: 09/08/2014, 07:20

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... Purification and characterization of a transmembrane domain-deleted form of lecithin retinol acyltransferase. Biochemistry 42, 6090–6098. 45 Muniz A, Vi...

Ngày tải lên: 14/02/2014, 14:20

... X-linked agammaglobulin- emia. A clinical and molecular analysis. Medicine (Baltimore) 75, 287–299. 27 Plebani A, Soresina A, Rondelli R, Amato GM, Azzari C, Cardinale F, Cazzola G, Consolini ... Hussain 1,2, *, Liang Yu 1,3, *, Rani Faryal 1,2 , Dara K. Mohammad 1 , Abdalla J. Mohamed 1,4 and C. I. Edvard Smith 1 1 Clinical Research Center, Department of Laboratory Medicine, Karolinska...

Ngày tải lên: 14/02/2014, 18:20

... Osanai K, Takahashi K, Nakamura K, Takahashi M, Ishigaki M, Sakuma T, Toga H, Suzuki T & Voelker DR (2005) Expression and characterization of Rab38, a new member of the Rab small G protein ... compilation ª 2006 FEBS and alkali extraction might not always be a reliable indicator of whether a protein is integral in the outer membrane [17,20–22]. As a distinct means to sep...

Ngày tải lên: 19/02/2014, 07:20

... the N-terminal domain, the comparable overall trypto- phan exposure in the mutants compared with the wild-type protein indicates that the structure of the N-terminal domain is maintained, at least in ... at a molar ratio of 0.5 : 1.0 Hsp25 : insulin (Fig. 7), with all mutants showing comparable suppression of insulin precipitation at this ratio. All of the glutamic acid residue...

Ngày tải lên: 07/03/2014, 04:20

... profile with a combined uncertainty U(c|f (a, b) > 0.6. Each gene was annotated with a KOG category and, for those pairings of two annotated genes, a tally of KOG category pairings was maintained. ... 2005) doi:10.1111/j.1742-4658.2005.04946.x The wealth of available genomic data has spawned a corresponding interest in computational methods that can impart biological meaning...

Ngày tải lên: 07/03/2014, 21:20

... vitro activity assay for HylP2 was performed using HA as substrate and ascorbic acid as an inhibitor. The activity of the enzyme was determined by measuring its ability to breakdown HA to unsaturated ... lactose Parul Mishra 1, *, R. Prem Kumar 2, *, Abdul S. Ethayathulla 2 , Nagendra Singh 2 , Sujata Sharma 2 , Markus Perbandt 3 , Christian Betzel 3 , Punit Kaur 2 , Alagiri Srinivasan 2 ,...

Ngày tải lên: 23/03/2014, 04:21

... using a human hippocampal cDNA library, a different PDZ domain- containing protein was found to interact with serine racemase, also requiring the C-terminal binding motif [30]. Protein interacting ... The finding of serine racemase interacting with the PDZ6 domain of GRIP and being activated was the first report on cellular interaction partners of serine race- mase and it raised sever...

Ngày tải lên: 30/03/2014, 04:20

... Artificial Intelligence and Tutoring Systems. Morgan Kaufmann, Los Altos, CA. 890 ungrammatical input? How to implement teaching strategies that are appropriate for language learning? These are ... (1992) An Introduction to Machine Translation, Academic Press, San Diego, CA, 361 p. Ingraham, B., Chanier T. & Emery,C. (1994) CAMILLE: A European Project to Develop Language Train...

Ngày tải lên: 31/03/2014, 04:20