báo cáo khoa học: " Half a gram – a thousand lives Lev Levinson" pptx

... purposes) Harm Reduction Journal Open Access Commentary Half a gram – a thousand lives Lev Levinson Address: Head of the Drug Policy Program, Institute for Human Rights, Moscow, Russia Email: Lev Levinson ... (instead of the arbitrary pharmacological doses in the Babayan Table), so that it was less likely that quantities that were actually small would be defined as large a...

Ngày tải lên: 11/08/2014, 18:20

... transfers – a danger foreseen is half avoided Philip Haji-Michael Consultant in Critical Care Medicine and Anaesthesia, Christie Hospital, Manchester, UK Corresponding author: Philip Haji-Michael, ... can then be fed back immediately so they can be acted upon. Such a small change would generate the sense of discomfort necessary to finally stimulate improvement. Commentary Critical c...

Ngày tải lên: 12/08/2014, 22:22

... CW, Malapeira J, Colome N, Moss M, Canals F & Arribas J (2008) Metastasis-associated C4. 4A, a GPI-anchored protein cleaved by ADAM10 and ADAM17. Biol Chem 389, 107 5–1 084. 60 Janes PW, Saha N, ... an interaction partner for ADAM10 that enhances a- sec- retase shedding of APP, probably by regulating matu- ration of the prodomain of ADAM10 [22]. The catalytical domain of ADAM10 conta...

Ngày tải lên: 16/02/2014, 09:20

... W, Rozovskaia T, Wassell R, Dubois G, Mazo A, Croce CM & Canaani E (2002) ALL-1 is a histone methyl- transferase that assembles a supercomplex of proteins involved in transcriptional regulation. ... 121, 87 3–8 85. 17 Yokoyama A, Wang Z, Wysocka J, Sanyal M, Aufiero DJ, Kitabayashi I, Herr W & Cleary ML (2004) Leukemia proto-oncoprotein MLL forms a SET1-like histone methyltra...

Ngày tải lên: 16/02/2014, 14:20

... fragment, and BiP Ala324–Leu653 as a SacI–XhoI fragment. Mature human ERp27 (Glu26–Leu273) was generated by PCR from IMAGE clone 5207225 as an NdeI–BamHI fragment. Mature E. coli DsbA (Ala20–Leu208) and ... studies [39,40]. Mature human BiP (Glu19–Leu653) was generated by PCR from a human liver cDNA library (Clontech, Mountain View, CA, USA) in two parts. BiP Glu1 9– Arg323 was constru...

Ngày tải lên: 16/02/2014, 14:20

... 257, 44 1–4 56. 19 Ravindra G & Balaram P (2005) Plasmodium falciparum triosephosphate isomerase: new insights into an old enzyme. Pure Appl Chem 77, 28 1–2 89. 20 Parthasarathy S, Ravindra G, Balaram ... mutations Mousumi Banerjee 1 , Hemalatha Balaram 2 and Padmanabhan Balaram 1 1 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India 2 Molecular Biology and Geneti...

Ngày tải lên: 18/02/2014, 11:20

... CGCTATTACCATGGTGATGC (nucleotides 458 8–4 608 of PCMV-Sport–b-gal plasmid) Sense ARS with PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaa aaccccaaaaaaatttacaaaaaaGTCGACaatgc Antisense ... overall CMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal...

Ngày tải lên: 18/02/2014, 12:20

... H, Ikeda K, Yasuda K, Kato A, Martin OR & Fan J-Q (2000) In vitro inhibition and intracellular enhancement of lysosomal a- galactosidase A activity in Fabry lymphoblasts by 1-deoxygalactono- jirimycin ... 1381 3–1 3818. 29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, Compain P, Martin O & Asano N (2006) alpha-1-C-octyl-1-de- oxynojirimycin as a pharmacological chaperone for Gau...

Ngày tải lên: 18/02/2014, 16:20

... electrospray ionization. Proc Natl Acad Sci USA 86, 907 5–9 078. 4 Tanaka K, Waki H, Ido Y, Akita S, Yoshida Y & Yoshida T (1988) Protein and polymer analyses up to m ⁄ z 100,000 by laser ionization ... protein identifications in complex mixtures, a dramatic advantage of the top-down approach is that a final separation stage can be done in the FT MS instrument. For example, after roug...

Ngày tải lên: 18/02/2014, 16:20

... 5¢-CGCCTCGAGCTATTTGGGCTCTT TCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCT GTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAA GAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGG ATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCC TCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCA CCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢- CGCGGATCCACCGTAGACACTTATGATATA-3¢ and 5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢; rOMM-64-III, 5¢-CGCGGATCCGCTGATG...

Ngày tải lên: 18/02/2014, 17:20