báo cáo khoa học: " Half a gram – a thousand lives Lev Levinson" pptx
báo cáo khoa học: " Half a gram – a thousand lives Lev Levinson" pptx
... purposes)Harm Reduction JournalOpen AccessCommentary Half a gram – a thousand lives Lev LevinsonAddress: Head of the Drug Policy Program, Institute for Human Rights, Moscow, RussiaEmail: Lev Levinson ... (insteadof the arbitrary pharmacological doses in the BabayanTable), so that it was less likely that quantities that wereactually small would be defined as large amounts.As a result, after ... large and exceptionally large amounts (in grams)Substances Babayan Table as of March 1, 2003 Decree of May 6, 2004 Decree of February, 7, 2006large amount exceptionally large amountlarge amount...
- 5
- 169
- 0
Báo cáo khoa học: "Critical care transfers – a danger foreseen is half avoided" pdf
... transfers – a danger foreseen is half avoidedPhilip Haji-MichaelConsultant in Critical Care Medicine and Anaesthesia, Christie Hospital, Manchester, UKCorresponding author: Philip Haji-Michael, ... can then be fed back immediately so they can beacted upon. Such a small change would generate the senseof discomfort necessary to finally stimulate improvement.CommentaryCritical care transfers ... therefore a lowpriority in service development. A second reason is a lack of a tension for change. We have always somehow managed. Thisis a problem that has truly been out of sight and out of...
- 2
- 172
- 0
Tài liệu Báo cáo khoa học: Upregulation of the a-secretase ADAM10 – risk or reason for hope? docx
... CW, Malapeira J, Colome N, Moss M,Canals F & Arribas J (2008) Metastasis-associatedC4. 4A, a GPI-anchored protein cleaved by ADAM10and ADAM17. Biol Chem 389, 107 5–1 084.60 Janes PW, Saha N, ... aninteraction partner for ADAM10 that enhances a- sec-retase shedding of APP, probably by regulating matu-ration of the prodomain of ADAM10 [22].The catalytical domain of ADAM10 contains a typical zinc-binding ... Gutenberg-University, Mainz, GermanyIdentification of ADAM10 as a functional a- secretase A disintegrin and metalloproteinase 10 (ADAM10)originally came into focus in genetical and biochemicalresearch as a peptide...
- 12
- 591
- 0
Tài liệu Báo cáo khoa học: Mixed lineage leukemia: a structure–function perspective of the MLL1 protein ppt
... W,Rozovskaia T, Wassell R, Dubois G, Mazo A, CroceCM & Canaani E (2002) ALL-1 is a histone methyl-transferase that assembles a supercomplex of proteinsinvolved in transcriptional regulation. ... 121, 87 3–8 85.17 Yokoyama A, Wang Z, Wysocka J, Sanyal M, AufieroDJ, Kitabayashi I, Herr W & Cleary ML (2004)Leukemia proto-oncoprotein MLL forms a SET1-likehistone methyltransferase complex ... TA, CopelandTD, Levine SS, Lee JC, Hayes DN, Shanmugam KS,Bhattacharjee A, Biondi CA et al. (2004) Meninassociates with a trithorax family histone methyltrans-ferase complex and with the hoxc8...
- 11
- 761
- 0
Tài liệu Báo cáo khoa học: Bacitracin is not a specific inhibitor of protein disulfide isomerase pptx
... fragment, andBiP Ala324–Leu653 as a SacI–XhoI fragment. Maturehuman ERp27 (Glu26–Leu273) was generated by PCRfrom IMAGE clone 5207225 as an NdeI–BamHI fragment.Mature E. coli DsbA (Ala20–Leu208) and ... studies[39,40]. Mature human BiP (Glu19–Leu653) was generatedby PCR from a human liver cDNA library (Clontech,Mountain View, CA, USA) in two parts. BiP Glu1 9– Arg323 was constructed as an NdeI–SacI fragment, ... showing a greater effect(29% decrease in aggregation rate) than PDI (18%decrease in rate). When 1mm bacitracin was added tothe PDI-catalyzed reaction the rate of aggregation ofrhodanese was significantly...
- 9
- 620
- 0
Tài liệu Báo cáo khoa học: Structural effects of a dimer interface mutation on catalytic activity of triosephosphate isomerase The role of conserved residues and complementary mutations pptx
... 257,44 1–4 56.19 Ravindra G & Balaram P (2005) Plasmodiumfalciparum triosephosphate isomerase: new insights intoan old enzyme. Pure Appl Chem 77, 28 1–2 89.20 Parthasarathy S, Ravindra G, Balaram ... mutationsMousumi Banerjee1, Hemalatha Balaram2and Padmanabhan Balaram11 Molecular Biophysics Unit, Indian Institute of Science, Bangalore, India2 Molecular Biology and Genetics Unit, Jawaharlal ... mutagenesis.Desired mutation Template gene Constructed mutant Primer sequence (5¢-to3¢) Restriction siteW11F WT W11F CACCATGGCTAGAAAATATTTTGTCGCAGCAAACTTCAAATGTAA NcoIW168F WT W168F GAACCTTTATTCGCTATTGGTACCGGTAAA...
- 15
- 635
- 0
Tài liệu Báo cáo khoa học: Expression of poly(A)-binding protein is upregulated during recovery from heat shock in HeLa cells doc
... CGCTATTACCATGGTGATGC (nucleotides 458 8–4 608 of PCMV-Sport–b-gal plasmid)Sense ARS with PstI and SalI CGGTTCACTAAACGAGCTCTGCTGCAGaaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaGTCGACaatgcAntisense ... overallCMV β-gal β-gal β-gal β-gal (1) β-gal A C D B (2) ARS-β-gal CMV AR S 5’-aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaa-3’ (3) TOP-β-gal CMV (4) TOP-ARS-β-gal 5’-ccttctccccggcggttagtgctgagagtgc-3’ ... aaaaaatccaaaaaaaatctaaaaaaatcttttaaaaaaccccaaaaaaatttacaaaaaaS. Ma et al. PABP expression during heat shock recoveryFEBS Journal 276 (2009) 55 2–5 70 ª 2008 The Authors Journal compilation ª 2008...
- 19
- 596
- 0
Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt
... H, Ikeda K, Yasuda K, Kato A, Martin OR & Fan J-Q (2000) In vitro inhibition andintracellular enhancement of lysosomal a- galactosidase A activity in Fabry lymphoblasts by 1-deoxygalactono-jirimycin ... 1381 3–1 3818.29 Yu L, Ikeda K, Kato A, Adachi I, Godin G, CompainP, Martin O & Asano N (2006) alpha-1-C-octyl-1-de-oxynojirimycin as a pharmacological chaperone forGaucher disease. Bioorganic ... 1-deoxygalactono-jirimycin and its derivatives. Eur J Biochem 267, 417 9– 4186.19 Fan JQ, Ishii S, Asano N & Suzuki Y (1999) Acceler-ated transport and maturation of lysosomal alpha-galac-tosidase A in Fabry...
- 7
- 507
- 0
Tài liệu Báo cáo khoa học: Top-down MS, a powerful complement to the high capabilities of proteolysis proteomics pdf
... electrosprayionization. Proc Natl Acad Sci USA 86, 907 5–9 078.4 Tanaka K, Waki H, Ido Y, Akita S, Yoshida Y &Yoshida T (1988) Protein and polymer analyses up tom ⁄ z 100,000 by laser ionization ... protein identifications in complex mixtures, a dramatic advantage of the top-down approach isthat a final separation stage can be done in theFT MS instrument. For example, after rough separa-tion of ... containing multiple mod-ifications [42].Fig. 9. ECD spectral data from the RNase A deamidation samples of Fig. 8. Deamidation at an individual residue of a specific product causes a 1 Da increase...
- 13
- 572
- 0
Tài liệu Báo cáo khoa học: Identification of a novel matrix protein contained in a protein aggregate associated with collagen in fish otoliths pdf
... 5¢-CGCCTCGAGCTATTTGGGCTCTTTCATCAT-3¢; rOMM-64-IV, 5¢-CGCGGATCCGCCCCTGTTAATGATGGAACC-3¢ and 5¢-CGCCTCGAGCTAAGAAGACTGGGCTGCCAG-3¢; rOMM-64-V, 5¢-CGCGGATCCAGGCAAGATTTTAAGCATCCA-3¢ and 5 ¢-CGCCTCCACCTAAGAGGCATCCTTGTCCAC-3¢; ... 5¢-CGCCTCCACCTAAGAGGCATCCTTGTCCAC-3¢; rOMM-64-II, 5¢-CGCGGATCCACCGTAGACACTTATGATATA-3¢ and5¢-CGCCTCGAG CTAAGAGTCAG CTTGCACGTC-3 ¢;rOMM-64-III, 5¢-CGCGGATCCGCTGATGTGACCAGTGATGAC-3¢ and 5¢-CGCCTCGAGCTATTTGGGCTCTTTCATCAT-3¢; ... 3-1-1 Minato,Hakodate, Hokkaido 041-8611, JapanTel ⁄ Fax: +81 138 40 5550E-mail: takagi@fish.hokudai.ac.jpDatabaseNucleotide sequence data are available inthe DDBJ ⁄ EMBL ⁄ GenBank databases...
- 12
- 568
- 0
Từ khóa: Nghiên cứu sự hình thành lớp bảo vệ và khả năng chống ăn mòn của thép bền thời tiết trong điều kiện khí hậu nhiệt đới việt namNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu tổ chức chạy tàu hàng cố định theo thời gian trên đường sắt việt namBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhát triển du lịch bền vững trên cơ sở bảo vệ môi trường tự nhiên vịnh hạ longPhát hiện xâm nhập dựa trên thuật toán k meansTăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtBÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namMÔN TRUYỀN THÔNG MARKETING TÍCH HỢPTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ