báo cáo khoa học: " Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment" ppsx
báo cáo khoa học: " Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment" ppsx
... 8:22 http://www.harmreductionjournal.com/content/8/1/22 Page 6 of < /b> 8 RESEARCH Open Access Prevalence < /b> and < /b> correlates < /b> of < /b> HIV, < /b> syphilis, < /b> and < /b> hepatitis < /b> B and < /b> C infection and < /b> harm reduction program use among male injecting drug users in Kabul, ... harm reduction program use among mal...
Ngày tải lên: 11/08/2014, 18:20
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... 33 CBPs bind to a broad selection of < /b> insoluble carbohydrates (e.g. ChbB, which binds both a- and < /b> b- chitin [21], and < /b> Chb3 from St. coelicolor, which binds a- chitin, b- chitin, colloidal chitin and < /b> chitosan ... 5¢-GGATGAGCTCTATACTCACATCTTGAGC- 3¢; reverse primer, 5¢-TTGTGGGCCCAACCAATCTATG AAGAATT-3¢). The PCR product was cloned using the zero blunt TOPO-cloni...
Ngày tải lên: 18/02/2014, 08:20
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... RHN(CH 2 ) 6 - CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH 2 ) 3 NHR (hpST3dODN), which was derived from the serum- inducible element of < /b> the human c- fos promoter, and < /b> RHN(CH 2 ) 6 - CATTTCCCTTAAATCGAAGATTTAAG GGAAATG-(CH 2 ) 3 NHR ... signaling induces apoptosis and < /b> cell cycle arrest of < /b> colon carcinoma cells. Am J Pathol 167, 969–980. 27 Kunnumakkara AB, Anand P & A...
Ngày tải lên: 18/02/2014, 08:20
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... GGGATCAGAGTTCATAGTGAAAAGAG hRhoB +86 GCG AAGCTTCGGCCTAGCTCTCTCCCGGGTCTC hRhoA )799 GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTAACGA hRhoB sense CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA ... CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA sense CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ACCACAGTCCATGCCA...
Ngày tải lên: 16/03/2014, 06:20
Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot
... results in greater lipid accumulation in the case of < /b> saturated fatty acid-rich particles, but not monounsaturated fatty acid-rich particles. Thus, dietary saturated fatty acids carried in chylomicron ... enriched in n)6or n)3 PUFAs. The faster uptake rate results in greater lipid accumulation in the case of < /b> SFAs, but not MUFA-rich particles, possibly because of < /b...
Ngày tải lên: 16/03/2014, 12:20
Báo cáo khoa học: Differential expression pattern of the novel serine⁄threonine kinase, STK33, in mice and men doc
... standard procedures [47]. Accordingly, template for the production of < /b> sense RNA was amplified with the primers 5¢-CAGAGATGCATAATACGACTCACTATAGG GAGAAACCCAGAAAGTGATGAG-3¢ and < /b> 5¢-TAGAA CTAAGCGAGCATG-3¢, ... whereas the template for the production of < /b> the antisense strand was amplified using the primers 5¢-CAGAGATGCATAATACGACTCACTATAG GGAGATAGAACTAAGCGAGCATG-3¢ and < /b> 5¢-AA...
Ngày tải lên: 16/03/2014, 23:20
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... 651–658. 14. Bourne, Y. & Cambillau, Ch (1993) The role of < /b> structural water molecules in protein-saccharide complexes. In Water and < /b> Biological Macromolecules (To pics in Molecular and < /b> S tructural Biology) ... derivatives. (A) Analysis of < /b> a blank sample ( eluate fraction between peaks in chromatograp hic profile shown in Fig. 3). (B) Analysis of < /...
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "Low-cost Enrichment of Spanish WordNet with Automatically Translated Glosses: Combining General and Specialized Models" pdf
... realizado por bombas bombs bombas dropping bombs cayendo bombas 0.1250 0.7059 0.5882 the act of < /b> acto de la acci ´ on y efecto acci ´ on y efecto acci´on y efecto informing by informaci´on de informing ... dos muchachos family name con la misma nombre familia tiene el mismo familia fama nombre familia 0.2857 0.2500 0.5000 an attack atacar por ataque ataque ataque con by dropping cayendo...
Ngày tải lên: 23/03/2014, 18:20
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
... a- crystallin, and < /b> human a- synuclein with human aB-crystallin. However, fibrillation of < /b> a- synuc- lein and < /b> j-casein at 37 C was inhibited in a similar degree by either a- crystallin or aB-crystallin (data ... components of < /b> this reaction include the disso- ciation of < /b> large a- crystallin and < /b> j-casein oligomers into smaller species, binding of...
Ngày tải lên: 30/03/2014, 04:20
Báo cáo khoa học: An NMR study of the interaction between the human copper(I) chaperone and the second and fifth metal-binding domains of the Menkes protein pot
... data are thus consistent with a mechanism in which HAH1 and < /b> any of < /b> the ATP 7A metal-binding domains interact via an unstable bi-molecular intermediate (transition state), whose concentration in ... region of < /b> yeast Atx1 and < /b> human HAH1 (upper), and < /b> of < /b> the various metal binding domains of < /b> yeast Ccc2 and < /b> human ATP 7A (lower). Positi...
Ngày tải lên: 30/03/2014, 15:20