báo cáo khoa học: " Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment" ppsx
báo cáo khoa học: " Prevalence and correlates of HIV, syphilis, and hepatitis B and C infection and harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment" ppsx
... 8:22http://www.harmreductionjournal.com/content/8/1/22Page 6 of < /b> 8RESEARCH Open Access Prevalence < /b> and < /b> correlates < /b> of < /b> HIV, < /b> syphilis, < /b> and< /b> hepatitis < /b> B and < /b> C infection and < /b> harm reduction program use among male injecting drug users in Kabul, ... harm reduction program use among male injecting drug users in Kabul, Afghanistan: A cross-sectional assessment. Harm Reduction Journal 2011 8:22.Submit your next manuscript to BioMed Central and < /b> ... 8:22http://www.harmreductionjournal.com/content/8/1/22Page 2 of < /b> 8using pharmaceutical agents alone in the last month.Other injecting risk behaviors, including lifetime and< /b> recent needle/syringe and < /b> injecting equipment sharing and < /b> aspirating and...
- 8
- 374
- 0
Tài liệu Báo cáo khoa học: The chitinolytic system of Lactococcus lactis ssp. lactis comprises a nonprocessive chitinase and a chitin-binding protein that promotes the degradation of a- and b-chitin doc
... 33 CBPs bind to a broad selection of< /b> insoluble carbohydrates (e.g. ChbB, which binds both a- and < /b> b- chitin [21], and < /b> Chb3 from St. coelicolor,which binds a- chitin, b- chitin, colloidal chitin and< /b> chitosan ... 5¢-GGATGAGCTCTATACTCACATCTTGAGC-3¢; reverse primer, 5¢-TTGTGGGCCCAACCAATCTATGAAGAATT-3¢). The PCR product was cloned using thezero blunt TOPO-cloning kit (Invitrogen, Carlsbad, CA,USA). The ... instructions, containingends compatible with the expression vector (forwardprimer, 5¢-GGTATTGAGGGTCGCCATGGTTATGTTCAATCACCA-3¢; reverse primer, 5¢-AGAGGAGAGTTAGAGCCTTACAAGAAGGGTCCAAAGA-3¢). The PCRproduct...
- 14
- 683
- 0
Tài liệu Báo cáo khoa học: Efficient killing of SW480 colon carcinoma cells by a signal transducer and activator of transcription (STAT) 3 hairpin decoy oligodeoxynucleotide – interference with interferon-c-STAT1-mediated killing pdf
... RHN(CH2)6-CATTTCCCGTAATCGAAGATTACGGGAAATG-(CH2)3NHR (hpST3dODN), which was derived from the serum-inducible element of < /b> the human c- fos promoter, and< /b> RHN(CH2)6- CATTTCCCTTAAATCGAAGATTTAAGGGAAATG-(CH2)3NHR ... signaling induces apoptosis and < /b> cell cycle arrest of < /b> colon carcinoma cells. Am JPathol 167, 969–980.27 Kunnumakkara AB, Anand P & Aggarwal BB (2008)Curcumin inhibits proliferation, invasion, angiogenesis and < /b> ... thecytotoxic action of < /b> thymidylate synthase inhibitors in colorectal carcinoma cells. Cancer Res 64, 6296–6303.33 Bene A, Kurten RC & Chambers TC (2004) Subcellularlocalization as a limiting...
- 11
- 558
- 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx
... GGGATCAGAGTTCATAGTGAAAAGAGhRhoB +86 GCGAAGCTTCGGCCTAGCTCTCTCCCGGGTCTChRhoA )799 GCGGGTACCAATGTGATGGGTGGACTGGThRhoA +166 GCGAAGCTTACCAGACCGTGGACTAACGAhRhoB sense CCCACCGTCTTCGAGAACTAhRhoBantisenseCTTCCTTGGTCTTGGCAGAGhRhoA ... CCCACCGTCTTCGAGAACTAhRhoBantisenseCTTCCTTGGTCTTGGCAGAGhRhoA sense CCAGACTAGATGTAGTATTTTTTGhRhoAantisenseATTAGAGCCAGATGCTTAAGTCCGAPDH-F ACCACAGTCCATGCCATCACGAPDH-R TCCACCACCCTGTTGCTGTAL. Vardouli et al. Rho ... pathway and < /b> of < /b> Smad functionthat operates in the context of < /b> a feedback inhibitoryloop [41], was able to block both the activation of< /b> RhoA GTPase activity and < /b> reorganization of < /b> the actincytoskeleton...
- 14
- 420
- 0
Báo cáo khoa học: Fatty acid composition of chylomicron remnant-like particles influences their uptake and induction of lipid accumulation in macrophages pot
... results in greater lipid accumulation in the case of < /b> saturatedfatty acid-rich particles, but not monounsaturated fatty acid-rich particles.Thus, dietary saturated fatty acids carried in chylomicron ... enriched in n)6orn)3 PUFAs. The faster uptake rate results in greaterlipid accumulation in the case of < /b> SFAs, but notMUFA-rich particles, possibly because of < /b> increasedintracellular metabolism ... 2006)doi:10.1111/j.1742-4658.2006.05552.xThe in uence of < /b> the fatty acid composition of < /b> chylomicron remnant-likeparticles (CRLPs) on their uptake and < /b> induction of < /b> lipid accumulation in macrophages was studied. CRLPs containing triacylglycerol...
- 9
- 349
- 0
Báo cáo khoa học: Differential expression pattern of the novel serine⁄threonine kinase, STK33, in mice and men doc
... standard procedures [47]. Accordingly, template forthe production of < /b> sense RNA was amplified with theprimers 5¢-CAGAGATGCATAATACGACTCACTATAGGGAGAAACCCAGAAAGTGATGAG-3¢ and < /b> 5¢-TAGAACTAAGCGAGCATG-3¢, ... whereas the template for theproduction of < /b> the antisense strand was amplified using theprimers 5¢-CAGAGATGCATAATACGACTCACTATAGGGAGATAGAACTAAGCGAGCATG-3¢ and < /b> 5¢-AACCCAGAAAGTGATGAG-3¢. The probes ... digital colour camera. Cellular localizationwas investigated with the Leica TCS SP2 laser scanningspectral confocal microscope using anti -a- tubulin as marker in parallel to anti-Stk33.DNA microarray...
- 15
- 389
- 0
Báo cáo khoa học: N-Terminal segment of potato virus X coat protein subunits is glycosylated and mediates formation of a bound water shell on the virion surface docx
... 651–658.14. Bourne, Y. & Cambillau, Ch (1993) The role of < /b> structural watermolecules in protein-saccharide complexes. In Water and< /b> Biological Macromolecules (To pics in Molecular and < /b> S tructuralBiology) ... derivatives. (A) Analysis of < /b> a blank sample ( eluate fraction between peaks in chromatograp hic profile shown in Fig. 3). (B) Analysis of < /b> a stan dard mixturecontaining Glc, Gal, Man, Fuc, GlcNAc, ... Shemyakin and < /b> Yu. A. Ovchinnikov Institute of < /b> Bioorganic Chemistry, Russian Academy of < /b> Sciences,Moscow, Russia;4V. N. Orekhovich Institute of < /b> Biomedical Chemistry, Russian Academy of < /b> Medical Sciences,...
- 10
- 398
- 0
Báo cáo khoa học: "Low-cost Enrichment of Spanish WordNet with Automatically Translated Glosses: Combining General and Specialized Models" pdf
... realizado por bombasbombs bombas dropping bombs cayendo bombas0.1250 0.7059 0.5882 the act of < /b> acto de la acci´on y efecto acci´on y efecto acci´on y efectoinforming by informaci´on de informing ... dos muchachosfamily name con la misma nombre familia tiene el mismofamilia fama nombre familia0.2857 0.2500 0.5000 an attack atacar por ataque ataque ataque conby dropping cayendo realizado ... Combining Sources: Translation Models In this section we study the possibility of < /b> combin-ing out -of-< /b> domain and < /b> in- domain translation mod-els aiming at achieving a good balance betweenprecision...
- 8
- 290
- 0
Báo cáo khoa học: Monitoring the prevention of amyloid fibril formation by a-crystallin Temperature dependence and the nature of the aggregating species pdf
... a- crystallin, and < /b> human a- synucleinwith human aB-crystallin. However, fibrillation of < /b> a- synuc-lein and < /b> j-casein at 37 C was inhibited in a similar degreeby either a- crystallin or aB-crystallin (data ... components of < /b> this reaction include the disso-ciation of < /b> large a- crystallin and < /b> j-casein oligomers intosmaller species, binding of < /b> a- crystallin to j-casein, con-formational alteration of < /b> j-casein and < /b> ... formation a- Synuclein (250 lm) was incubated in NaCl ⁄ Piat 37 C. At 0, 25, 49 and < /b> 65 h of < /b> incubation, aB-crystallin wasadded to the samples containing a- synuclein at a 0.5 : 1.0molar ratio of < /b> aB-crystallin...
- 16
- 577
- 0
Báo cáo khoa học: An NMR study of the interaction between the human copper(I) chaperone and the second and fifth metal-binding domains of the Menkes protein pot
... data are thus consistent with a mechanism in which HAH1 and < /b> any of < /b> the ATP 7A metal-binding domains interact via an unstablebi-molecular intermediate (transition state), whoseconcentration in ... region of < /b> yeast Atx1 and < /b> human HAH1(upper), and < /b> of < /b> the various metal binding domains of < /b> yeast Ccc2 and < /b> human ATP 7A (lower). Positively charged areas are blue, nega-tively charged areas are in red. ... of< /b> ATP 7B present a relatively complex picture in whichthe number of < /b> metal-binding domains contained in each speci c construct appeared to affect significantlycopper(I) capabilities [30]. In fact,...
- 7
- 368
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitQuản lý hoạt động học tập của học sinh theo hướng phát triển kỹ năng học tập hợp tác tại các trường phổ thông dân tộc bán trú huyện ba chẽ, tỉnh quảng ninhPhối hợp giữa phòng văn hóa và thông tin với phòng giáo dục và đào tạo trong việc tuyên truyền, giáo dục, vận động xây dựng nông thôn mới huyện thanh thủy, tỉnh phú thọPhát hiện xâm nhập dựa trên thuật toán k meansNghiên cứu về mô hình thống kê học sâu và ứng dụng trong nhận dạng chữ viết tay hạn chếNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngTìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíChuong 2 nhận dạng rui roQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)BT Tieng anh 6 UNIT 2Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM