báo cáo khoa học: " The Chinese government’s response to drug use and HIV/AIDS: A review of policies and programs" potx
báo cáo khoa học: " The Chinese government’s response to drug use and HIV/AIDS: A review of policies and programs" potx
... Open Access The Chinese government’s response to drug use and HIV/AIDS: A review of policies and programs Jianhua Li 1* , Toan H Ha 2 , Cunmin Zhang 1 , Hongjie Liu 2 Abstract Illicit drug use has ... Program (2007BAI07B01) awarded to JL and from the US National Institutes of Health (5R21DA023893-02) awarded to HL. Author details 1 Yunnan Institute fo...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo khoa học: "Radiation Induced Temporal Lobe Necrosis in Patients with Nasopharyngeal Carcinoma: a Review of New Avenues in Its Management" doc
... of astrocytes further causes leakage of VEGF. This then acts on the capillary targets and causes neovascularization. The new vessels are leaky and further perpetuate edema and blood brain barrier ... parts of Africa and Inuits of Alaska[1]. Till date radiotherapy remains the mainstay treatment of NPC[2]. A definitive radiation dose between 66 Gy and 70 Gy needs...
Ngày tải lên: 09/08/2014, 09:21
Tài liệu Báo cáo khoa học: The alr2505 (osiS) gene from Anabaena sp. strain PCC7120 encodes a cysteine desulfurase induced by oxidative stress docx
... similar to that of IscS (Fig. 1A) , with a two-domain organization and the presence of both a- helices and b-strands. On the basis of these data and the fact that alr2505-expression is specifically ... proteins reconstitutes an active adenylate cyclase. The cAMP– catabolite activator protein complex can than activate the transcription of target genes (e.g. those o...
Ngày tải lên: 18/02/2014, 04:20
Báo cáo khoa học: The twin-arginine translocation (Tat) systems from Bacillus subtilis display a conserved mode of complex organization and similar substrate recognition requirements doc
... TatAyCy, and the data show that TorA activity is localized exclusively in the cytoplasmic fraction, with no export apparent. Thus, although both TatAdCd and TatAyCy were able to translocate the three ... chromosomal DNA with primers RTEAyF (5¢-CGCGTCTCGCATGCCGATCGGTCCTGGAAGCCT TGCTG-3¢) and JJystrep02 (5¢-ATATTCTAGATTA TTT TTCAAACTGTGGGTGCGACCAATTCGATTGCCCAG AAGACACGTCCCG-3¢). R...
Ngày tải lên: 16/03/2014, 04:20
báo cáo khoa học: " The QUIT-PRIMO provider-patient Internetdelivered smoking cessation referral intervention: a cluster-randomized comparative effectiveness trial: study protocol" ppt
... coordinators can provide each other backup and further enhance use of ReferaSmoker.org. U sing an academic detailing approach, our study team will walk the implementation coordinators through the ... AL, USA. 6 School of Health Professions, University of Alabama at Birmingham, Birmingham, AL, USA. Authors’ contributions TKH, the principal investigator of the study, conduct...
Ngày tải lên: 10/08/2014, 10:23
báo cáo khoa học: "Still too little qualitative research to shed light on results from reviews of effectiveness trials: A case study of a Cochrane review on the use of lay health workers" potx
... and a thematic analysis was carried out. Data collection and analysis was led by an experienced qualitative researcher. The main author of the randomised trial was also involved in the qualitative ... common theme among trial participants was their appreciation of the similarities between them and the lay health workers, for example with regard to social background o...
Ngày tải lên: 10/08/2014, 10:23
Báo cáo khoa học: Human skin cell stress response to GSM-900 mobile phone signals In vitro study on isolated primary cells and reconstructed epidermis docx
... COHU, San Diego, CA) and analysed for thickness using aphelion Ò image analysis software. The mean thickness was calculated along the whole length of the photographed area, based on three areas per ... measured), followed by a return to a level below the nominal base line. This type of adaptation has been described as a normal response to thermal and chemical stres...
Ngày tải lên: 07/03/2014, 11:20
Báo cáo khoa học: "You Can’t Beat Frequency (Unless You Use Linguistic Knowledge) – A Qualitative Evaluation of Association Measures for Collocation and Term Extraction" pot
... constrained candidates. All measures assign a score to the candidates and thus produce a ranked output list. 3.4 Experimental Setup In order to determine any potential merit of the above measures, ... Toulouse, France, July 9-11, 2001. San Francisco, CA: Mor- gan Kaufmann. Katerina T. Frantzi, Sophia Ananiadou, and Hideki Mima. 2000. Automatic recognition of multi-word ter...
Ngày tải lên: 31/03/2014, 01:20
Báo cáo khoa học: "Escherichia coli O157:H7 adherence to HEp-2 cells is implicated with curli expression and outer membrane integrity" potx
... ( msbB1 / msbB2 ) mutant [15] of strain 4304 did not show any of AA-like or LA adhesion pattern (E and F of Fig. 1). Autoaggregation test We alternatively examined degree of curliation of the CR+ Escherichia coli ... mutant (panel D) were defective in curliation. 120 Sang-Hyun Kim and Yong-Hwan Kim adherence to HEp-2 cells and that the adherence of curliated stain 430...
Ngày tải lên: 07/08/2014, 17:22
Báo cáo khoa học: "Androgen receptor status predicts response to chemotherapy, not risk of breast cancer in Indian women" doc
... under multivariate analysis as data was available only for 51% cases. The association of AR2 a lleles among case s and controls was analyzed in the matched form (McNemar’s test) related to age of onset of ... influence of AR on response to neoadjuvant chemotherapy and clinical outcome. Materials and methods: Genotyping of the AR CAG repeat region was done on 70 p...
Ngày tải lên: 09/08/2014, 03:21