Báo cáo y học: " Predictors of metabolic monitoring among schizophrenia patients with a new episode of second-generation " docx
Báo cáo y học: " Predictors of metabolic monitoring among schizophrenia patients with a new episode of second-generation " docx
... health monitoring of patients with schizophrenia. Am J Psychiatry 2004, 161(8):1334-1349. 14. American Diabetes Association, American Psychiatric Association, American Association of Clinical ... primarily due to cardiovas- cular disease [8]. Second-generation antipsychotics (SGA) or atypical drugs have gained widespread acceptance for the management of patients with schiz...
Ngày tải lên: 11/08/2014, 17:20
Báo cáo y học: "Pre-hospital intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service"
... pre-hospital emer- gency physicians regard pre-hospital airway management as challenging and recognise that such procedures likely warrant special training beyond the experience of in- hospital airway ... intubation by anaesthesiologists in patients with severe trauma: an audit of a Norwegian helicopter emergency medical service. Scandinavian Journal of Trauma, Resuscitation and E...
Ngày tải lên: 25/10/2012, 09:56
Báo cáo y học: "Surgical and medical emergencies on board European aircraft: a retrospective study of 10189 cases"
... correspondence: Aer Lingus, Aeroflot, Air Berlin, Air Malta, Air France, Air Scotland, Alitalia, Austrian, bmi, British Airways, Brussels, Bulgaria Air, Condor, Croatia Airlines, Cyprus Airways, Czech Airlines, ... data analysis and inter- pretation of the data as well as the writing of the manuscript. FGB participated in the data analysis and interpretation of the study. DS particip...
Ngày tải lên: 25/10/2012, 10:31
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt
... 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGAGTTTGGG-3¢. ... H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGA...
Ngày tải lên: 24/03/2014, 04:21
Báo cáo y học: "Fluvoxamine for aripiprazole-associated akathisia in patients with schizophrenia: a potential role of sigma-1 receptors" ppt
... Kimura Y, Sakata M, Naganawa M, Oda K, Miyatake R, Fujisaki M, Shimizu E, Shirayama Y, Iyo M, Hashimoto K: High occupancy of sigma-1 receptors in the human brain after single oral administration of ... human brain at therapeutic doses, * Correspondence: furuse@asahikawa-rch.gr.jp 1 Department of Psychiatry, Asahikawa Red Cross Hospital, Asah ikawa, Japan Furuse and Hashimoto Annals o...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "Fluvoxamine for blonanserin-associated akathisia in patients with schizophrenia: report of five cases." pps
... tsufuruse49@yahoo.co.jp 1 Department of Psychiatry, Asahikawa Red Cross Hospital, Asahikawa, Japan Full list of author information is available at the end of the article Furuse and Hashimoto Annals of ... the akathisia of patients with schizophrenia treated with the new atypical antipsychotic drug blonanserin. Results: The global score on the Barnes Akathisia Scale in fi...
Ngày tải lên: 08/08/2014, 23:21
Báo cáo y học: "To keep the catch – that is the question: a personal account of the 3rd Annual EULAR Congress, Stockholm" potx
... over 300 and there was a global spread of speakers, rather than a European spread. I think this is exactly the right policy, although probably to some extent controversial. The chairman of the scientific ... cytokines with invited speakers Tim Vyse, Jerry Saklatvala and Ian McInnes, and with a session on molecular aspects of tissue repair, which I co-chaired. Every conscientio...
Ngày tải lên: 09/08/2014, 06:22
Báo cáo y học: "Osteoarthritis and nutrition. From nutraceuticals to functional foods: a systematic review of the scientific evidence" pps
... aggrecanase activity and basal aggrecanase and collagenase activity, whereas, in contrast, n-6 stimulated the basal aggrecanase and collagenase activity. n-3 also decreased the IL1-induced mRNA expression ... boron, a cocktail of vitamins and selenium, and a cocktail of minerals), on plant extracts (bromelain, Rosa canina, Harpagophytum procum- bens, Uncaria tomentosa, and Uncaria gui...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc
... interplay of absorptive and reflective capacity. In Organizational Learning and Knowledge 5th International Conference; 20 May 2003 Lancaster University. 37. Braadbaart O, Yusnandarshah B: Public ... expressed in a way that could be inferred as an organisational characteristic (e.g., 'Our employees resist changing to new ways of doing things' [94]), and were excluded. Categ...
Ngày tải lên: 11/08/2014, 05:21
Báo cáo y học: " Seeking help for depression from family and friends: A qualitative analysis of perceived advantages and disadvantages" pps
... to you may fob it off and say it will go away or you’ll feel better and the problem may escalate”. (viii) Category 8 - Accessibility issues Two participants indicated that lack of separation ... changes in social behaviour associated with depression can be marked and may ultimately be associated with the alienation of friends and family and a consequent loss of their social su...
Ngày tải lên: 11/08/2014, 16:21