báo cáo khoa học: " A cluster randomized trial to improve adherence to evidence-based guidelines on diabetes and reduce clinical inertia in primary care physicians in Belgium: study protocol [NTR 1369]" potx

... in Ara- bidopsis [27]. Although DEAD or DEAH box RNA helicases have been shown to participate in cold, salt and osmotic stresses [21–23], whether DExH box RNA helicases are involved in plant responses ... 1 was shown to be critical for the bio- genesis of microRNAs and Arabidopsis development [24,25]. Arabidopsis TEBICHI, containing an N-termi- nal DELH box RNA...

Ngày tải lên: 14/02/2014, 18:20

... strains have already been isolated and characterized [12,13], mainly from Pseudomonas aeruginosa strains [21,37–43]. The carbo- hydrate backbone of the so-called inner core region of Pseudomonas ... Thomas-Oates, J.E. & Brade, H. (1994) Preparation and structural analysis of oligosaccharide monophosphates obtained from the lipopolysaccharide of recombinant strain...

Ngày tải lên: 19/02/2014, 13:20

... CCCACCGTCTTCGAGAACTA hRhoB antisense CTTCCTTGGTCTTGGCAGAG hRhoA sense CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ACCACAGTCCATGCCATCAC GAPDH-R TCCACCACCCTGTTGCTGTA L. Vardouli ... (5Â-to3Â) hRhoB -825 GGGATCAGAGTTCATAGTGAAAAGAG hRhoB +86 GCG AAGCTTCGGCCTAGCTCTCTCCCGGGTCTC hRhoA )799 GCG GGTACCAATGTGATGGGTGGACTGGT hRhoA +166 GCG AAGCTTACCAGACCGTGGACTAACGA hRhoB sen...

Ngày tải lên: 16/03/2014, 06:20

... induces the transcription of a- amylase genes [1]. Functional analyses of a- amylase gene promoters using transient expression assays with reporter genes have shown both GA and abscisic acid (ABA) may ... induced by GA. The interaction between GA and ABA may be important in controlling the a- amylase gene expression. TheeffectsofGAandABAona-amylase gene transcription have b...

Ngày tải lên: 16/03/2014, 18:20

... sequence database with the accession number AB154368. Results Purification and characterization of the R -stereoselective amidase from Pseudomonas sp. MCI3434 An amidase, acting on piperazine-2-tert-butylcarboxamide was ... amidase from Pseudomonas sp. MCI3434 acting on piperazine-2- tert -butylcarboxamide Hidenobu Komeda 1 , Hiroyuki Harada 1 , Shingo Washika 1...

Ngày tải lên: 30/03/2014, 13:20

... Singapore, 2-7 August 2009. c 2009 ACL and AFNLP A Non-negative Matrix Tri-factorization Approach to Sentiment Classification with Lexical Prior Knowledge Tao Li Yi Zhang School of Computer Science Florida ... convergence. We call this approach Matrix Factorization with Lex- ical Knowledge (MFLK) and outline the precise steps in the table below. Algorithm 1 Matrix...

Ngày tải lên: 30/03/2014, 23:20

... JS, PB and DP conducted patient exams and participated in data collection. TD par- ticipated in the collection of data and data analyses. CL and XX assisted in writing the manuscript. All authors read ... after radiation therapy was initiated, the skin was usually treated daily with an aloe vera-based gel. The patients or their caregivers would apply the ge...

Ngày tải lên: 09/08/2014, 10:21

... of 15 STUDY PROTO C O L Open Access A cluster randomized trial of standard quality improvement versus patient-centered interventions to enhance depression care for African Americans in the primary ... delivered to them in their office by a primary care physician/psychiatrist team; tailored, individualized feedback regarding their interviewi...

Ngày tải lên: 11/08/2014, 05:21

... the Alberta Health Care Insurance Plan (AHCIP) Payment Database, and the AHCIP Registry Dataset. All children 0–6 years of age and 6–16 years of age who are Albertan residents, and who have been ... urban areas. Practice pattern outcomes Development of data abstraction sheet After an informal review of medical records, a customized Access relational database was developed. This...

Ngày tải lên: 11/08/2014, 05:22

... citation purposes) Implementation Science Open Access Study protocol A cluster randomised controlled trial in primary dental care based intervention to improve professional performance on routine ... dental care; the development, validation and standardisation of an index for the assessment of restorative care. Thesis University of Amsterdam...

Ngày tải lên: 11/08/2014, 05:22

... the effectiveness of the messages: general practice-held data; centrally-held and publicly available QOF data; and cen- trally-held laboratory data. We shall only use the QOF and laboratory data if we are unable ... is known about the effectiveness of the methods in increas- ing appropriate behaviour; the one study examining this was a trial of adding guidelines to patients&apos...

Ngày tải lên: 11/08/2014, 05:22

... when a trained facilitator meets with staff and clinicians in each practice over several months to assist the team in addressing an issue, such as improving risk factors for diabetes complications. ... are to: 1. Evaluate the effectiveness and sustainability of PF to improve risk factors for type 2 diabetes complications across a variety of primary ca...

Ngày tải lên: 11/08/2014, 05:22

... purposes) Implementation Science Open Access Study protocol A cluster randomized trial to improve adherence to evidence-based guidelines on diabetes and reduce clinical inertia in primary care physicians in Belgium: ... to address non -adherence to evidence-based guidelines and to reduce &apos ;clinical inertia& apos; in prim...

Ngày tải lên: 11/08/2014, 16:21

... randomized controlled trial aimed at implementation of local quality improvement collaboratives to improve prescribing and test ordering performance of general practitioners: Study Protocol Jasper ... format. This format is based on rational criteria for laboratory test registration to facilitate the integration of the individual databases in...

Ngày tải lên: 11/08/2014, 16:21