Báo cáo y học: " Use of Non-parametric Item Response Theory to develop a shortened version of the Positive and Negative Syndrome Scale (PANSS)" potx

Báo cáo y học: " Use of Non-parametric Item Response Theory to develop a shortened version of the Positive and Negative Syndrome Scale (PANSS)" potx

Báo cáo y học: " Use of Non-parametric Item Response Theory to develop a shortened version of the Positive and Negative Syndrome Scale (PANSS)" potx

... Fresan A, De la Fuente-Sandoval C, Loyzaga C, Garcia-Anaya M, Meyenberg N, Nicolini H, et al.: A forced five-dimensional factor analysis and concurrent validity of the Positive and Negative Syndrome ... 7 to 49) and for General Psychopathology subscale (total scores 16 to 112). For the dataset used in this analysis, the total Positive and Negative Subscale...

Ngày tải lên: 11/08/2014, 16:20

63 460 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. H1 7A: 5¢-GCATTTTGTTCTGGTACACGGCGGATGTCTCG GAGCTTGG-3¢.H-8 6A: 5¢-GGTTGTTCTTCTTGG CCATAGCTTTGGTGGCATGAGTTTGGG-3¢. ... min) and the supernatant was analysed by the standard HPLC assay [6]. Assay for the production...

Ngày tải lên: 24/03/2014, 04:21

8 345 0
Báo cáo y học: "Human pregnancy safety for agents used to treat rheumatoid arthritis: adequacy of available information and strategies for developing post-marketing data" ppsx

Báo cáo y học: "Human pregnancy safety for agents used to treat rheumatoid arthritis: adequacy of available information and strategies for developing post-marketing data" ppsx

... regarding any and all exposures that may have occurred during pregnancy. Conclusion The availability of several new medications available to the rheumatologist for the treatment of patients with RA has dramatically ... First, the study objectives are not limited to evaluation of the safety of a single drug but rather to the evaluation of the wide variety of...

Ngày tải lên: 09/08/2014, 08:22

10 501 0
Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

Báo cáo y học: "What can management theories offer evidence-based practice? A comparative analysis of measurement tools for organisational context" doc

... projects: the interplay of absorptive and reflective capacity. In Organizational Learning and Knowledge 5th International Conference; 20 May 2003 Lancaster University. 37. Braadbaart O, Yusnandarshah ... OL capa- bility [90]. Existing tools are used because indicators are already empirically supported, operationalised, and easily identified and compared, and because our primary...

Ngày tải lên: 11/08/2014, 05:21

15 386 0
Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

Báo cáo y học: " PDGF-Rα gene expression predicts proliferation, but PDGF-A suppresses transdifferentiation of neonatal mouse lung myofibroblasts" ppt

... fibroblast prolifera- tion and differentiation. Stimulatory and inhibitory sig- nals normally confine myofibroblasts to the period of pulmonary alveolarization and myofibroblasts are rarely observed ... (B and F), followed by Alexa-Fluor 647-conjugated secondary antibody (A6 47, y- axis). Negative controls stained with the secondary antibody only are shown in A and E....

Ngày tải lên: 12/08/2014, 14:20

17 203 0
Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc

Báo cáo y học: "Systematic review: Intra-aortic balloon counterpulsation pump therapy: a critical appraisal of the evidence for patients with acute myocardial infarction" doc

... of patients later randomized to IABP therapy compared to 46% of patients in the standard therapy arm. Intravenous heparin was used for a mean of 5 days in both the IABP and standard therapy arms. ... Randomized IABP Trial [10], angioplasty was used to restore patency in 90% of patients later rand- omized to IABP therapy, and 83% later assigned to stand- ard care. I...

Ngày tải lên: 12/08/2014, 18:20

6 575 0
Báo cáo y học: "Tranexamic acid attenuates inflammatory response in cardiopulmonary bypass surgery through blockade of fibrinolysis: a case control study followed by a randomized double-blind controlled trial" doc

Báo cáo y học: "Tranexamic acid attenuates inflammatory response in cardiopulmonary bypass surgery through blockade of fibrinolysis: a case control study followed by a randomized double-blind controlled trial" doc

... study. The IR in car- Table 1 Part 1. Patient characteristics and associations with inflammatory response after cardiopulmonary bypass Variables Inflammatory response (n = 34) No inflammatory response ... expressed as frequency and percentage. Quantitative variables are expressed as mean ± standard deviation or as median and interquartile range in the case control study and...

Ngày tải lên: 13/08/2014, 08:21

10 360 0
Báo cáo y học: "Learning lessons from field surveys in humanitarian contexts: a case study of field surveys conducted in North Kivu, DRC 2006-2008" pot

Báo cáo y học: "Learning lessons from field surveys in humanitarian contexts: a case study of field surveys conducted in North Kivu, DRC 2006-2008" pot

... accuracy of the data analysis. All authors partici- pated in the conception and design of the study; analysis and interpretation of data; drafting the paper and revising it critically for substantial ... Stand- ardized Monitoring and Assessment of Relief and Transi- tions (SMART) initiative aims to ensure standardization of planning, training, analysis and repo...

Ngày tải lên: 13/08/2014, 13:21

8 326 0
Báo cáo y học: "Triple selectin knockout (ELP-/-) mice fail to develop OVA-induced acute asthma phenotype" pptx

Báo cáo y học: "Triple selectin knockout (ELP-/-) mice fail to develop OVA-induced acute asthma phenotype" pptx

... h locally and systemically, the next question to be addressed was the actual amount of the cytokine media- tors that were being synthesized and released by the inflammatory cells both for propelling their ... leads to a complete inhibition of the development of the asthma phenotype in the OVA-treated ELP-/- mouse. The failure of the eosinophils to travel...

Ngày tải lên: 11/08/2014, 03:20

14 114 0
Từ khóa:
w