báo cáo khoa học: " Translating three states of knowledge–discovery, invention, and innovation" pps

Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc

Báo cáo khoa học: The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids doc

... The ATPase activities of sulfonylurea receptor 2A and sulfonylurea receptor 2B are influenced by the C-terminal 42 amino acids Heidi de Wet, Constantina Fotinou, Nawaz Amad, Matthias Dreger and ... NBD2B (792 lm), and NBD2A (529 lm). The different activities of NBD2A and NBD2B could result from an inhibitory effect of the C-terminal 42...
Ngày tải lên : 06/03/2014, 11:20
  • 9
  • 620
  • 0
Báo cáo khoa học: "Weakly-Supervised Acquisition of Open-Domain Classes and Class Attributes from Web Documents and Query Logs" pot

Báo cáo khoa học: "Weakly-Supervised Acquisition of Open-Domain Classes and Class Attributes from Web Documents and Query Logs" pot

... contents of query logs during the extraction of labeled classes of instances from Web documents, we acquire thousands (4,583, to be exact) of open-domain classes covering a wide range of topics and ... period, symptoms, ] Query logs Web documents (1) (2) Figure 1: Overview of weakly-supervised extraction of class instances, class labels and class at...
Ngày tải lên : 08/03/2014, 01:20
  • 9
  • 447
  • 0
Báo cáo khoa học: "Determining the Specificity of Terms using Compositional and Contextual Information" pptx

Báo cáo khoa học: "Determining the Specificity of Terms using Compositional and Contextual Information" pptx

... words of target terms. For example, the distribution of co-occurrence words of the terms, the distribution of predicates which have the terms as arguments, and the distribution of modi- fiers of ... proposed specificity measuring meth- ods for terms based on information theory like measures using compositional and contextual information of terms....
Ngày tải lên : 08/03/2014, 04:22
  • 6
  • 385
  • 0
Báo cáo khoa học: On the mechanism of a-amylase Acarbose and cyclodextrin inhibition of barley amylase isozymes pdf

Báo cáo khoa học: On the mechanism of a-amylase Acarbose and cyclodextrin inhibition of barley amylase isozymes pdf

... Santimone, M. (1996) The mechanism of porcine 3878 N. Oudjeriouat et al. (Eur. J. Biochem. 270) Ó FEBS 2003 On the mechanism of a -amylase Acarbose and cyclodextrin inhibition of barley amylase isozymes Naăma ... Thus the longer the substrate, the higher was the activity. Inhibition by acarbose Inhibition of amylose hydrolysis occurred in the...
Ngày tải lên : 08/03/2014, 08:20
  • 9
  • 437
  • 0
Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

Báo cáo khoa học: The sulfur atoms of the substrate CoA and the catalytic cysteine are required for a productive mode of substrate binding in bacterial biosynthetic thiolase, a thioester-dependent enzyme doc

... thiolase superfam- ily. The results obtained indicate that the sulfur atoms of both the enzyme and the substrate are important for the correct productive mode of binding of CoA in the thiolase active ... crucial role for sulfur sulfur interactions in defining the catalytically competent binding mode of CoA in the active site. The...
Ngày tải lên : 16/03/2014, 04:20
  • 13
  • 472
  • 0
Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

Báo cáo khoa học: Ternary complex formation of pVHL, elongin B and elongin C visualized in living cells by a fluorescence resonance energy transfer–fluorescence lifetime imaging microscopy technique docx

... 5Â-CTAGACCA CCATGGAGGAACAGAAGCTGATCAGTGAGGAAG ACCTGGATATCCCGGGTTAACT-3Â and 5Â-CTAGAG TTAACCCGGGATATCCAGGTCTTCCTC ACTGATCA GCTTCTGTTCCTCCATGGTGGT-3Â, and 5Â-CTAGAC CACCATGGACTACAAAGACGATGACGATAAAGAT ATCCCGGGTTAACT-3Â and 5Â-CTAGAGTTAACCCGG GATATCTTTATCGTC ... insertion of < /b> the annealed fragment of < /b> the synthesized oligonucleotides, 5Â-CTAGAC CACCATGTACCCCTACGACGTGCCCGACTACGC...
Ngày tải lên : 16/03/2014, 05:20
  • 9
  • 420
  • 0
Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx

Báo cáo khoa học: Modeling hydration mechanisms of enzymes in nonpolar and polar organic solvents potx

... the two initial steps. Note that the curves can easily discriminate nonpolar and polar solvents. In nonpolar solvents, water is highly retained at the enzyme surface, whereas in polar solvents, ... number of water molecules per cluster. Again, the behavior in nonpolar and polar sol- vents is easily distinguishable by this property. In the presence of nonpolar...
Ngày tải lên : 16/03/2014, 10:20
  • 13
  • 433
  • 0
Báo cáo khoa học: The structural comparison of the bacterial PepX and human DPP-IV reveals sites for the design of inhibitors of PepX activity pot

Báo cáo khoa học: The structural comparison of the bacterial PepX and human DPP-IV reveals sites for the design of inhibitors of PepX activity pot

... Sites for the design of inhibitors of PepX activity FEBS Journal 272 (2005) 20502059 ê 2005 FEBS 2051 The structural comparison of the bacterial PepX and human DPP-IV reveals sites for the design ... perform the automated molecular docking of the ligand valine-pyrroli- dide into DPP-IV and PepX active sites. The structure of D...
Ngày tải lên : 23/03/2014, 13:20
  • 10
  • 561
  • 0
Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

Báo cáo khoa học: H NMR study of the molecular structure and magnetic properties of the active site for the cyanomet complex of O2-avid hemoglobin from the trematode Paramphistomum epiclitum pdf

... move away from the heme and the B-helix moves closer to the heme in the WT metHbthanintherWTmetHbH 2 O crystal structure, with the result that the ligated water is lost in the latter complex [16,17]. Prior ... position E7 as the source of the H- bond to ligand on the basis of a partial sequence, which had indicated a Tyr on the distal E-helix. The similari...
Ngày tải lên : 23/03/2014, 17:22
  • 14
  • 504
  • 0
Báo cáo khoa học: Expression profile of PIN, AUX ⁄ LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress pot

Báo cáo khoa học: Expression profile of PIN, AUX ⁄ LAX and PGP auxin transporter gene families in Sorghum bicolor under phytohormone and abiotic stress pot

... and transcription analysis of the auxin transporter genes SbPIN, SbLAX and SbPGP in sorghum, including expression under abiotic stress, was reported here. The expression level of these auxin transporters was affected ... plant transport proteins would facilitate understanding of the coordination between the PIN, AUX ⁄ LAX and PGP gene families in...
Ngày tải lên : 29/03/2014, 09:20
  • 16
  • 417
  • 0
Báo cáo khoa học: Glycan profiling of urine, amniotic fluid and ascitic fluid from galactosialidosis patients reveals novel oligosaccharides with reducing end hexose and aldohexonic acid residues ppt

Báo cáo khoa học: Glycan profiling of urine, amniotic fluid and ascitic fluid from galactosialidosis patients reveals novel oligosaccharides with reducing end hexose and aldohexonic acid residues ppt

... of urine, amniotic fluid and ascitic fluid from galactosialidosis patients reveals novel oligosaccharides with reducing end hexose and aldohexonic acid residues Cees Bruggink 1,2 , Ben J. H. M. ... al. Novel oligosaccharides in galactosialidosis FEBS Journal 277 (2010) 29702986 ê 2010 The Authors Journal compilation ê 2010 FEBS 2983 Glycan...
Ngày tải lên : 29/03/2014, 09:20
  • 17
  • 291
  • 0
Báo cáo khoa học: Novel target genes of the Wnt pathway and statistical insights into Wnt target promoter regulation potx

Báo cáo khoa học: Novel target genes of the Wnt pathway and statistical insights into Wnt target promoter regulation potx

... al. Wnt target genes and the regulation of their promoters FEBS Journal 272 (2005) 16001615 ê 2005 FEBS 1609 Novel target genes of the Wnt pathway and statistical insights into Wnt target promoter ... possible function of Wnt target genes and the regulation of their promoters S. Ziegler et al. 1614 FEBS Journal 272 (2005) 16001615 ê 2...
Ngày tải lên : 30/03/2014, 16:20
  • 16
  • 300
  • 0
Báo cáo khoa học nông nghiệp " Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam " docx

Báo cáo khoa học nông nghiệp " Investigation of rice kernel cracking and its control in the field and during post-harvest processes in the Mekong Delta of Vietnam " docx

... 10: Increased mechanical strength of the rice due to tempering 22 1. Institute Information Project Name Investigation of rice kernel cracking and its control in the field and during post-harvest ... of rice and to investigate the effect of tempering on the increase in the mechanical strength of rice. This was the preliminary work m...
Ngày tải lên : 21/06/2014, 06:20
  • 16
  • 512
  • 0
Báo cáo y học: "Translating three states of knowledge–discovery, invention, and innovation" pot

Báo cáo y học: "Translating three states of knowledge–discovery, invention, and innovation" pot

... knowledge translation and technology transfer, suggested the states of knowledge, and linked discovery, invention, and innovation in the model. JLF conducted a review of academic and industry literature and applied ... is utility, in addition to the novelty and feasibility of the prior knowledge states. A technology-based solu- tion may be feasible and novel in a labo...
Ngày tải lên : 11/08/2014, 05:21
  • 14
  • 211
  • 0
báo cáo khoa học: " Translating three states of knowledge–discovery, invention, and innovation" pps

báo cáo khoa học: " Translating three states of knowledge–discovery, invention, and innovation" pps

... Journal of Assistive Technology Outcomes and Benefits 2008, 2:1-35. doi:10.1186/1748-5908-5-9 Cite this article as: Lane and Flagg: Translating three states of knowledge–discovery, invention, and ... phase. Lane and Flagg Implementation Science 2010, 5:9 http://www.implementationscience.com/content/5/1/9 Page 9 of 14 DEBATE Open Access Translating three states...
Ngày tải lên : 11/08/2014, 16:20
  • 14
  • 168
  • 0
Từ khóa: