... Taq DNA polymerase (Promega, Madison, WT, USA) using the primers 5¢-CACACTACACTGGGAAGCAGAG ACTCCAGC-3¢ and 5¢-AGCTGGCCCAGCAGCCATACACAGTTAAAG- 3¢. The cDNA was subcloned into the EcoRV site of ... that mammalian Gup1, a mem- ber of the MBOAT superfamily bearing sequence simi- larity to HHAT, acts as a negative regulator of N-terminal palmitoylation of Shh. Several reports have demo...
Ngày tải lên: 18/02/2014, 16:20
... Haji ˇ c, Massimiliano Ciaramita, Richard Johans- son, Daisuke Kawahara, Maria Ant ` onia Mart ´ ı, Llu ´ ıs M ` arquez, Adam Meyers, Joakim Nivre, Sebastian Pad ´ o, Jan ˇ St ˇ ep ´ anek, Pavel ... Boulder, Colorado, June. Associa- tion for Computational Linguistics. Ryohei Sasano, Daisuke Kawahara, and Sadao Kuro- hashi. 2004. Automatic construction of nominal case frames and its applic...
Ngày tải lên: 17/03/2014, 00:20
Báo cáo khoa học: "LX-Center: a center of online linguistic services" pdf
... service takes a Portuguese nomi- nal form — a form of a noun or an adjective, in- cluding adjectival forms of past participles –, to- gether with a bundle of inflectional feature values — values of ... technology tools for the Portuguese language and are made available to foster the education, research and de- velopment in natural language science and tech- nology. This paper...
Ngày tải lên: 17/03/2014, 02:20
Báo cáo khoa học: Vps4 regulates a subset of protein interactions at the multivesicular endosome doc
... GAGAATCAGTGTCGACTTCATCTATAAAAATAATAGAAGGTTTATT Vps4 SalIF GCCCATATTCGTCGACGCGCTAACAGGTACCAGAGGAGAAGGAGAGAGCGAAGCAAGTAG Vps4 Dstr R GGGCGGATCCTCTGCTTTTCTTTATC YEE F CTGGACACAGCCACGCAGTATACAGCATACTATAACGG YEE R CCGTTATAGTATGCTGTATACTGCGTGGCTGTGTCCAG IRA ... The Authors Journal compilation ª 2007 FEBS Table 2. Primers used for mutagenesis. Primer Sequence (5¢-to3¢) Vps4 Upstr F CGCTGCAGTAAGAGC...
Ngày tải lên: 23/03/2014, 09:20
Báo cáo khoa học: Aspergillus nidulans a-galactosidase of glycoside hydrolase family 36 catalyses the formation of a-galacto-oligosaccharides by transglycosylation doc
... (pNPa GlcNAc), a- d-xyl opyranose (pNPaXyl), a- d-manno- pyranose (pNPaMan), a- l-arabinopyranose (pNPaAra), a- l-arabinofuranose (pNP aAraf) and a- l-rhamnopyra- nose (pNPaRha) (less than 10 lm pNP liberated ... and superimposition of an equilibrium mixture of a- and b-galactose from Oryza sativa a- galactosidase [28], N-acetyl -a- galactosamine from Gallus gallus a- N-acet- ylga...
Ngày tải lên: 29/03/2014, 21:20
Báo cáo khoa học: "Automatically Constructing a Lexicon of Verb Phrase Idiomatic Combinations" pptx
... can motivate a speaker to use a variant in place of a canonical form (Glucksberg, 1993). Nevertheless, lexical and syntactic flexibility may well be used as partial indicators of semantic ana- lyzability, ... the lexicosyntactic be- haviour of idiomatic combinations. We put for- ward a means for automatically discovering the set of syntactic variations that are tolerated by...
Ngày tải lên: 31/03/2014, 20:20
báo cáo khoa học: "Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a case report" pptx
... the article as it appeared upon acceptance. Fully formatted PDF and full text (HTML) versions will be made available soon. Pyosalpinx as a sequela of labial fusion in a post-menopausal woman: a ... the anatomical area of the right adnexa. Our patient had developed a pyosalpinx as a Sequela of labial fusion. At laparoscopy the right pyosalpinx was identified and resected, w...
Ngày tải lên: 10/08/2014, 22:20
báo cáo khoa học: "Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases" pps
... 5:447 http://www.jmedicalcasereports.com/content/5/1/447 Page 3 of 5 CAS E REP O R T Open Access Dysphagia as a manifestation of esophageal tuberculosis: a report of two cases Joana Gomes * , Ana Antunes, Aurora Carvalho ... growth as esophageal polyps may also be present as in case two [5,11]. Esophageal carcinoma is part of the differential diagnosis as was the case for both o...
Ngày tải lên: 10/08/2014, 23:20
báo cáo khoa học:" Tissue engineering: a challenge of today''''s medicine" potx
... research papers, pub- lished in a wide array of (material-, biological-, biomedical-, biophysical-, and clinical-based) journals, covering all aspects of basic research, preclinical testing and ... Medicine therefore as a thematically broad ranged journal, including all disciplines involved in the head and neck area. We hope this journal will attract basic researchers and clinicians w...
Ngày tải lên: 11/08/2014, 23:22
Báo cáo khoa học: " Procalcitonin as a marker of bacterial infection in the emergency department: an observational study" pptx
... infection, and as a marker of disease severity R12 Critical Care February 2004 Vol 8 No 1 Chan et al. Research Procalcitonin as a marker of bacterial infection in the emergency department: an observational ... Memorial Hospital Linkou Medical Center, Taoyuan, Taiwan 2 Associated Professor, The School of Medical Technology, Chang Gung University, Taoyuan, Taiwan 3 Assistant Professor...
Ngày tải lên: 12/08/2014, 20:20