báo cáo khoa học: "Three-dimensional kinematic motion analysis of a daily activity drinking from a glass: a pilot study" pdf
Tài liệu Báo cáo khoa học: "Subjectivity and Sentiment Analysis of Modern Standard Arabic" doc
... 2011. c 2011 Association for Computational Linguistics Subjectivity and Sentiment Analysis of Modern Standard Arabic Muhammad Abdul-Mageed Department of Linguistics & School of Library & Info. ... significant improvement in classification performance. 2 Approach To our knowledge, no SSA annotated MSA data ex- ists. Hence we decided to create our own SSA an- notated data. 1 2.1...
Ngày tải lên: 20/02/2014, 05:20
Báo cáo khoa học: Proteomic and biochemical analysis of 14-3-3-binding proteins during C2-ceramide-induced apoptosis pot
... using mass spectrometry data. Electrophoresis 20, 3551–3567. 88 Wakeyama H, Akiyama T, Takahashi K, Amano H, Kadono Y, Nakamura M, Oshima Y, Itabe H, Nakayama KI, Nakayama K et al. (2007) Negative feedback ... (CABI- MER, Seville, Spain). Monoclonal antibody against a- tubulin was from Sigma. Antibody against STAT3 was from Cell Signalling (Danvers, MA, USA). Antibodies against VASP, HIP...
Ngày tải lên: 06/03/2014, 22:21
Báo cáo khoa học: Semi-nested PCR analysis of unknown tags on serial analysis of gene expression potx
... length of the smear is distributed from about mRNA mRNA NBAAAAAAA-3′ NBAAAAAAA-3′ NBAAAAAAA Modified oligo (dT) NVTTTTTTT NBAAAAAAA NVTTTTTTT NBAAAAAAA NVTTTTTTT NBAAAAAAA NVTTTTTTT NBAAAAAAA NVTTTTTTT 16 16 16 16 16 16 16 16 5′ 5′ 5′-cap ... spermatozoa were amplified by PCR with the use of Takara Ex Taq Hot Start Version (TaKaRa), with the primary library sequences serving as the templ...
Ngày tải lên: 07/03/2014, 04:20
Báo cáo khóa học: Mutational and computational analysis of the role of conserved residues in the active site of a family 18 chitinase docx
... glycosyl- transferase elucidate catalysis in the alpha-amylase family. Nat. Struct. Biol. 6, 432–436. 16. Terwisscha van Scheltinga, A. C., Armand, S., Kalk, K.H., Isogai, A. , Henrissat, B. & Dijkstra, ... circulans, whereas it may be mutated to asparagine without loss of activity in other family 18 chitinases [28,30]. Preliminary results of a comparative study of available s...
Ngày tải lên: 07/03/2014, 14:20
Báo cáo khoa học: Structural and functional analysis of the interaction of the AAA-peroxins Pex1p and Pex6p pptx
... GAATCATTATGAAGCGGTGAGAGCTAATTTTGAAGG TGCTCGTACGCTGCAGGTCGAC KU1012 TATTTACAAATTTACCTATACGCTCTGAGTTGATATTAC ATCGATGAATTCGAGCTCG KU1130 GCTAATAACAACTAATATCACTAACAGAAGACCATTAC CCCGTACGCTGCAGGTCGAC KU1131 GGAGGATTTATCAAAAGCTACTTCGAAAGCTAGGAACG AACGTACGCTGCAGGTCGAC KU1132 ... CGGATCCATGGTTAAAGATATTATCGAAAGGCATTTGC KU617 CCGCATGCGGCCGCTCAAGATGGTGTAAACGCACTAA GCG KU718 CACTAGCAGAACGTACTACGGTGTGGTTTA...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: Modular metabolic control analysis of large responses in branched systems – application to aspartate metabolism potx
... state value), is a tenta- tive range estimated from information available for Arabidopsis mutants. In a mutant of Arabidopsis in which inhibition of AK by Lys was abolished, a six-fold increase ... responses in branched systems – application to aspartate metabolism Fernando Ortega 1 and Luis Acerenza 2 1 Computational Biology, Advanced Science and Technology Laboratory, AstraZenec...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Structural and mutational analysis of TenA protein (HP1287) from the Helicobacter pylori thiamin salvage pathway – evidence of a different substrate specificity doc
... (Stratagene, La Jolla, CA, USA). The primers used were: 5¢-TATATCATTCA GGATTATTTG TATCTTTTAGAATACGCTAAGGTG-3 ¢ (forward, the mutagenesis codon underlined) and 5¢-TT AGCGTATTCTAAAAG ATACAAATAATCCTGAATGA TATAAAAAC-3¢ ... H, Yao M, Watanabe N & Tanaka I (2004) Struc- ture analysis of PH1161 protein, a transcriptional acti- vator TenA homologue from the hyperthermophilic archaeon Pyro...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khoa học: Antibody-based proteomics Analysis of signaling networks using reverse protein arrays pdf
... rela- tively easy to translate antibody validation by western blotting into an array format. Although RPAs have gained popularity as an alter- native to classical western blots because of a dramati- cally ... 2 Pancreas 3 Pancreas 4 Pancreas 5 Pancreas 6 Pancreas 7 Pancreas 8 TSC-2 0 500 1000 1500 2000 2500 Heart 1 Heart 2 Heart 3 Heart 4 Heart 5 Heart 6 Heart 7 Heart 8 Pancreas 1 Pancrea...
Ngày tải lên: 16/03/2014, 00:20
Báo cáo khóa học: Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding pdf
... 431 Mutational and structural analysis of cobalt-containing nitrile hydratase on substrate and metal binding Akimasa Miyanaga 1 , Shinya Fushinobu 1 , Kiyoshi Ito 2 , Hirofumi Shoun 1 and Takayoshi ... the National Project on Protein Structural and Functional Analysis. References 1. Yamada, H. & Kobayashi, M. (1996) Nitrile hydratase and its application to industrial production of...
Ngày tải lên: 16/03/2014, 16:20
Báo cáo khoa học: Conformational and functional analysis of the lipid binding protein Ag-NPA-1 from the parasitic nematode Ascaridia galli potx
... Timanova A, Marti T, Walter RD & Bankov I (1997) Isolation and partial characterization of a fatty-acid- Conformation, ligand binding and distribution of nematode protein Ag-NPA-1 R. Jordanova ... than for fatty acids. They nota- bly differ in their amino acid sequence from NPAs [11]. Ag-NPA-1 from the parasitic nematode Ascarida galli is a member of the NPAs family [12]. I...
Ngày tải lên: 16/03/2014, 18:20