báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx

báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx

báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx

... with intrauterine and intrapartum trans mission. Intrauterine transmission was estimated by infant HIV status at birth. Intrapartum transmission was assigned to infants who were HIV negative at ... case-control study of HIV MTCT using infants of HIV( +) mothers, drawn from a cohort study of malaria and HIV in pregnancy in Blantyre, Malawi. Whole genome sca...

Ngày tải lên: 11/08/2014, 12:20

11 294 0
Báo cáo y học: "A whole-genome assembly of the domestic cow, Bos taurus" potx

Báo cáo y học: "A whole-genome assembly of the domestic cow, Bos taurus" potx

... base calls, indicating a higher error rate in BCM4. The B. taurus Y chromosome Because two-thirds of the data came from a female cow, and the male DNA was based on a BAC library (Materials and methods), ... finding that the initial assembly contained two unusual contaminants, Acinetobacter bau- mannii and Serratia marcescens. These bacteria are not used as sequencing reagents and ar...

Ngày tải lên: 14/08/2014, 21:20

10 258 0
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf

... 5¢-ATGGACGCTGAAT TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab- start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT CCGTCACG-3¢;Abstop, ... equilibrated in buffer A containing 8 m urea, and the sample was eluted with a gradient of 0–300 mm NaCl in buff...

Ngày tải lên: 18/02/2014, 13:20

16 691 0
Tài liệu Báo cáo khoa học: A differential scanning calorimetry study of tetracycline repressor pptx

Tài liệu Báo cáo khoa học: A differential scanning calorimetry study of tetracycline repressor pptx

... functional groups and the C-terminal side chains of helix a4 , and helices a5 and a6 . This initiates conformational changes starting with C-terminal unwinding and shifting of the short helix a6 in each ... enthalpy values of the proteins (in the absence and presence of ligand) as a function of scan rate are shown in Table 2. A small decrease in denaturation enthalp...

Ngày tải lên: 20/02/2014, 02:21

10 493 1
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot

... 3. BLASTP-based protein database searching and functional classification. All peptide sequence tags (Table 2) were searched against the dog genome database using BLASTP, version 2.2.16. Database ... It was demonstrated that acidic phospholipids inhibit intra- molecular association between the N- and C-terminal regions of vinculin, exposing actin-binding and protein kinase C phosphorylati...

Ngày tải lên: 07/03/2014, 06:20

20 506 0
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf

... Azuma T, Nakajima M, Yasuda K, Hayakumo T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi- cance of cathepsin E in pancreatic juice in the diagnosis of pancreatic ductal adenocarcinoma. ... T, Takahashi T, Taggart RT, Akamine A, Ezaki M, Nakanishi H, Sakai H & Yamamoto K (1993) Isolation and characterization of recombinant human cathepsin E expressed in Chinese hamster...

Ngày tải lên: 07/03/2014, 09:20

12 645 0
Báo cáo khoa học: A ribonuclease zymogen activated by the NS3 protease of the hepatitis C virus potx

Báo cáo khoa học: A ribonuclease zymogen activated by the NS3 protease of the hepatitis C virus potx

... ribonucleolytic activity of RNase A but allowing the manifestation of near-wild-type activity upon cleavage. It contains a sequence recognized by the plasmepsin II protease from the malarial parasite Plasmodium ... giving a k cat ⁄ K m value that is one-quarter that of wild-type RNase A (Table 1). The change in both kinetic parameters on activation suggests that the lin- ker a...

Ngày tải lên: 07/03/2014, 11:20

9 392 0
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx

... domain (aa 321–447), heme domain (aa 519–592), FAD domain (aa 623–728) and NADH domain (residues 744–858) [27]. A unique 17-amino-acid insertion in the molybdopterin-binding domain iden- tified in ... (GenBank accession number X52869) was amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA) by PCR using sense primer 5¢-ATCAAAACAACCAAAA TGGCCAAGTTGACCAGTGC-3¢ and antisense primer 5¢-GAAT...

Ngày tải lên: 07/03/2014, 21:20

11 668 0
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx

Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx

... generated from a large battery of grammars that incorporate many features from the domain of natural language. At this point the multilingual language domain contains sentence patterns and ... investigators interested in computational models of natural language acquisition. 2 The Language Domain Database The focus of the language domain database, (hereafter LDD), is to ma...

Ngày tải lên: 08/03/2014, 04:22

8 368 0
Báo cáo khoa học: A simple protocol to study blue copper proteins by NMR pot

Báo cáo khoa học: A simple protocol to study blue copper proteins by NMR pot

... important tool to study paramagnetic proteins Plastocyanin is a good model system to address features of paramagnetic copper proteins in terms of assignment strategy. Indeed, the previously available ... understanding of the role of metal ions in protein folding and misfolding related diseases [12–20], as well as the understanding at the atomic level of protein–protein inter...

Ngày tải lên: 08/03/2014, 08:20

10 573 0
Từ khóa:
w