báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx
báo cáo khoa học: " A whole genome association study of mother-to-child transmission of HIV in Malawi" potx
... with intrauterine and intrapartum trans mission.
Intrauterine transmission was estimated by infant HIV
status at birth. Intrapartum transmission was assigned to
infants who were HIV negative at ... case-control study of HIV MTCT using infants of HIV( +) mothers, drawn from a
cohort study of malaria and HIV in pregnancy in Blantyre, Malawi. Whole genome sca...
Báo cáo y học: "A whole-genome assembly of the domestic cow, Bos taurus" potx
... base
calls, indicating a higher error rate in BCM4.
The B. taurus Y chromosome
Because two-thirds of the data came from a female cow, and
the male DNA was based on a BAC library (Materials and
methods), ... finding that the initial assembly
contained two unusual contaminants, Acinetobacter bau-
mannii and Serratia marcescens. These bacteria are not used
as sequencing reagents and ar...
Tài liệu Báo cáo khoa học: A facile method for expression and purification of the Alzheimer’s disease-associated amyloid b-peptide pdf
... 5¢-ATGGACGCTGAAT
TCCGTCACGACTCTGGTTACGAAGTTCACCACCAG
AAGCTGGTG-3¢;Abb, 5¢-GTTCACCACCAGAAGCT
GGTGTTCTTC GCTGAA GACGT GGGTTCT AACAAG
GGTGCT-3¢;Abc, 5¢-CACAACGCCACCAACCATCAGA
CCGATGATAGCACCCTTGTTAGAACCCAC-3¢;Ab-
start, 5¢-GCGTAGGGTCGACATATGGACGCTGAATT
CCGTCACG-3¢;Abstop, ... equilibrated
in buffer A containing 8 m urea, and the sample was eluted
with a gradient of 0–300 mm NaCl in buff...
Tài liệu Báo cáo khoa học: A differential scanning calorimetry study of tetracycline repressor pptx
... functional groups
and the C-terminal side chains of helix a4 , and helices a5
and a6 . This initiates conformational changes starting with
C-terminal unwinding and shifting of the short helix a6 in
each ... enthalpy values of the proteins
(in the absence and presence of ligand) as a function of scan
rate are shown in Table 2. A small decrease in denaturation
enthalp...
Báo cáo khoa học: A novel 2D-based approach to the discovery of candidate substrates for the metalloendopeptidase meprin pot
... 3. BLASTP-based protein database searching and functional classification. All peptide sequence tags (Table 2) were searched against
the dog genome database using
BLASTP, version 2.2.16. Database ... It was
demonstrated that acidic phospholipids inhibit intra-
molecular association between the N- and C-terminal
regions of vinculin, exposing actin-binding and protein
kinase C phosphorylati...
Báo cáo khoa học: A new approach for distinguishing cathepsin E and D activity in antigen-processing organelles pdf
... Azuma T, Nakajima M, Yasuda K, Hayakumo
T, Mukai H, Sakai T & Kawai K (2000) Clinical signifi-
cance of cathepsin E in pancreatic juice in the diagnosis
of pancreatic ductal adenocarcinoma. ... T, Takahashi T, Taggart
RT, Akamine A, Ezaki M, Nakanishi H, Sakai H &
Yamamoto K (1993) Isolation and characterization of
recombinant human cathepsin E expressed in Chinese
hamster...
Báo cáo khoa học: A ribonuclease zymogen activated by the NS3 protease of the hepatitis C virus potx
... ribonucleolytic activity of RNase A but
allowing the manifestation of near-wild-type activity
upon cleavage. It contains a sequence recognized by
the plasmepsin II protease from the malarial parasite
Plasmodium ... giving a k
cat
⁄ K
m
value that is one-quarter that
of wild-type RNase A (Table 1). The change in both
kinetic parameters on activation suggests that the lin-
ker a...
Báo cáo khoa học: A new molecular tool for transgenic diatoms Control of mRNA and protein biosynthesis by an inducible promoter–terminator cassette docx
... domain (aa 321–447), heme domain (aa 519–592), FAD
domain (aa 623–728) and NADH domain (residues 744–858) [27]. A unique 17-amino-acid insertion in the molybdopterin-binding domain iden-
tified in ... (GenBank accession number X52869) was
amplified from pZEOSV (Invitrogen, Carlsbad, CA, USA)
by PCR using sense primer 5¢-ATCAAAACAACCAAAA
TGGCCAAGTTGACCAGTGC-3¢ and antisense primer
5¢-GAAT...
Báo cáo khoa học: "A Word-Order Database for Testing Computational Models of Language Acquisition" docx
... generated from a large
battery of grammars that incorporate many features
from the domain of natural language.
At this point the multilingual language domain
contains sentence patterns and ...
investigators interested in computational models of
natural language acquisition.
2 The Language Domain Database
The focus of the language domain database,
(hereafter LDD), is to ma...
Báo cáo khoa học: A simple protocol to study blue copper proteins by NMR pot
... important tool to study
paramagnetic proteins
Plastocyanin is a good model system to address features of
paramagnetic copper proteins in terms of assignment
strategy. Indeed, the previously available ... understanding of the
role of metal ions in protein folding and misfolding related
diseases [12–20], as well as the understanding at the atomic
level of protein–protein inter...
Từ khóa: