báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf

báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf

báo cáo khoa học: "Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat" pdf

... 14 RESEARC H ARTIC L E Open Access Brachypodium distachyon: a new pathosystem to study Fusarium head blight and other Fusarium diseases of wheat Antoine Peraldi 1* , Giovanni Beccari 2 , Andrew ... DON appears to function as a virulence factor in Bd as it does in wheat. Bd is proposed as a valuable model for undertaking studies of Fusarium head blight...
Ngày tải lên : 11/08/2014, 11:20
  • 14
  • 342
  • 0
Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

Báo cáo khoa học: MicroRNA-373, a new regulator of protein phosphatase 6, functions as an oncogene in hepatocellular carcinoma pdf

... GATCCGCTTTGTGTAAGTAATTTGATTCAAGAA TCAAATTACTTACAAGTTTTTTGAATTCTCGAGA PPP6C-siR-Bottom AGCTTCTCGAGAATTCAAAAAACTTTGTGTAAGTAATT TGATCTCTTGAACAAATTACTTACACAAAGAG PPP6C-forward AGGGAATTCATGGCGCCGCTAGACCTGGC PPP6C-reverse ... CGGGATCCTCTTGTATTACCCTCTA PPP6C-3¢UTR-antisense GCGAATTCTCCATCGTGCC PPP6C-3¢UTR-mut-sense TTTTTATTGTGGAGTATGCTGCTGAAATG PPP6C-3¢UTR-mut-antisense ATTTCAGCAGCATACTCCACAATAAAAAG...
Ngày tải lên : 14/03/2014, 23:20
  • 11
  • 396
  • 0
Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx

Báo cáo khoa học: Methanoferrodoxin represents a new class of superoxide reductase containing an iron–sulfur cluster docx

... chromosomal DNA of M. mazei as template and the following primers: mm0632for, 5¢-ATGGTAGGTCTCAAATGATAGGAA ATGAAGAAAAAATAAATAAGC-3¢; and mm0632rev, 5¢-ATGGTAGGTCTCAGCGCTGGCTTTCCAGACGCA TTTTTTGC-3¢. The ... detail, and a considerable amount of biochemical, crystallographic and spectroscopic information has been reported [7]. Methanosarcina mazei is one of the methanogenic archae...
Ngày tải lên : 28/03/2014, 23:20
  • 10
  • 539
  • 0
Báo cáo khoa học: " icuroom.net – a new critical care addendum" docx

Báo cáo khoa học: " icuroom.net – a new critical care addendum" docx

... provides an editorial of published articles based on the University of Pittsburgh’s journal club’s critique of the current published literature. Competing interests The author(s) declare that they have ... website provides professional evidence based critical care practice guidelines. Critical Care Evidence-Based Medicine Journal Club – http://ccforum.com/articles/browse.asp?sort=Journa...
Ngày tải lên : 12/08/2014, 23:20
  • 2
  • 185
  • 0
Báo cáo khoa học: "Co-dispersion: A Windowless Approach to Lexical Association" ppt

Báo cáo khoa học: "Co-dispersion: A Windowless Approach to Lexical Association" ppt

... subject of systematic study, we have what is known in scale-aware disciplines as multi-scalar analysis, of which fractal analysis is a variant. Although a certain amount has been written about ... Hardcastle (2005) and Washtell (2007) apply this same concept to measuring word pair associations, the former via a somewhat ad-hoc approach, the latter through an extension of...
Ngày tải lên : 24/03/2014, 03:20
  • 9
  • 237
  • 0
Báo cáo hóa học: " Research Article A New Strong Convergence Theorem for Equilibrium Problems and Fixed Point Problems in Banach Spaces" pptx

Báo cáo hóa học: " Research Article A New Strong Convergence Theorem for Equilibrium Problems and Fixed Point Problems in Banach Spaces" pptx

... operators in Banach spaces: properties and applications,” in Theory and Applications of Nonlinear Operators of Accretive and Monotone Type,vol. 178 of Lecture Notes in Pure and Applied Mathematics, ... Theory and Applications 19 W. Takahashi and Kei Zembayashi, “Strong and weak convergence theorems for equilibrium problems and relatively nonexpansive mappings i n Banac...
Ngày tải lên : 21/06/2014, 05:20
  • 14
  • 393
  • 0
Báo cáo hóa học: " Research Article A New Approach to q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials" pdf

Báo cáo hóa học: " Research Article A New Approach to q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials" pdf

... q-Bernoulli Numbers and q-Bernoulli Polynomials Related to q-Bernstein Polynomials Mehmet Ac¸ikg ¨ oz, Dilek Erdal, and Serkan Araci Department of Mathematics, Faculty of Science and Arts, University of Gaziantep, ... International Conference of Numerical Analysis and Applied Mathematics (ICNAAM ’10), AIP, Rhodes, Greece, March 2010. 5 L. Carlitz, “q-Bernoulli numbers and...
Ngày tải lên : 21/06/2014, 07:20
  • 9
  • 442
  • 0
Báo cáo hóa học: " Research Article A New Iterative Method for Solving Equilibrium Problems and Fixed Point Problems for Infinite Family of Nonexpansive Mappings" pptx

Báo cáo hóa học: " Research Article A New Iterative Method for Solving Equilibrium Problems and Fixed Point Problems for Infinite Family of Nonexpansive Mappings" pptx

... Kinderlehrer and G. Stampacchia, An Introduction to Variational Inequalities and Their Applications, vol. 88 of Pure and Applied Mathematics, Academic Press, New York, NY, USA, 1980. 10 I. Yamada, “The ... 2005. 19 V. Colao, G. Marino, and H K. Xu, “An iterative method for finding common solutions of equilibrium and fixed point problems,” Journal of Mathematical Analysis...
Ngày tải lên : 21/06/2014, 11:20
  • 18
  • 406
  • 0
Báo cáo hóa học: "Research Article A New Frame Memory Compression Algorithm with DPCM and VLC in a 4×4 Block" pptx

Báo cáo hóa học: "Research Article A New Frame Memory Compression Algorithm with DPCM and VLC in a 4×4 Block" pptx

... typically degrades image quality, and therefore, additional image quality degradation may limit the practical use of FMC algorithms. Extensive research efforts have been made to reduce the size and ... block diagram of the encoder. The hardware accelerators for motion estimation, deblocking filter, intraprediction, and variable length coder are imple- mented in hardware and the re...
Ngày tải lên : 21/06/2014, 19:20
  • 18
  • 377
  • 0

Xem thêm