Báo cáo khoa hoc:" Seizures as the first manifestation of chromosome 22q11 2 deletion syndrome in a 40-year old man: a case report" doc
Báo cáo khoa hoc:" Seizures as the first manifestation of chromosome 22q11.2 deletion syndrome in a 40-year old man: a case report" doc
... purposes) Journal of Medical Case Reports Open Access Case report Seizures as the first manifestation of chromosome 22 q11. 2 deletion syndrome in a 40-year old man: a case report Adriano R Tonelli* 1 , Kalyan ... with chromosome 22 q11. 2 deletion syndrome can have a variety of brain abnormalities when assessed by neuroimaging. Basal ga...
Ngày tải lên: 11/08/2014, 10:22
Báo cáo khoa học: Expressed as the sole Hsp90 of yeast, the a and b isoforms of human Hsp90 differ with regard to their capacities for activation of certain client proteins, whereas only Hsp90b generates sensitivity to the Hsp90 inhibitor radicicol pdf
... (Hsp9 0a, forward primer GCTTGAAGCAAGCCTCGATGCCT GAGGAAACCCAGACCCAA, reverse primer CAGT AGCTTCATCTTTTCGGTCTACTTCTTCCATGCGTGA; Hsp90b, forward primer GCTTGAAGCAAGCCTCGAT GCCTGAGGAAGTGCACCATGGA, reverse ... expression in S. cerevisiae was constructed by PCR amplification of the Hsp9 0a ORF using the forward primer AAATAA GTCG ACATGCCTGAGGAAACCCAG (SalI site underlined; Hsp9 0a start...
Ngày tải lên: 23/03/2014, 07:20
Báo cáo khoa học: "Plants as De-Worming Agents of Livestock in the Nordic Countries: Historical Perspective, Popular Beliefs and Prospects for the Future" docx
... carrot (Daucus carota), brassicas (Brassica spp), the onion group (Al- lium spp.), as well as all kinds of berries have had widespread use against parasites in the Nordic as well as most other countries. ... 55, 70 A. ursinum ramson ramslök ramsløk * rams-løg karhunlaukka bjarnarlaukur M H W 34 Asparagus of cinalis asparagus sparris asparges asparges * ruokaparsa M 9 Iris ps...
Ngày tải lên: 12/08/2014, 15:20
Tài liệu Báo cáo khoa học: nsights into the reaction mechanism of glycosyl hydrolase family 49 Site-directed mutagenesis and substrate preference of isopullulanase doc
... CCGGTG GTcGAcTTTGGTTtcACGCCC SalI E273Q ACGTACTGCTgTCCGGAA AGtACtCCATGGCCGC ScaI D353N TCCAATCCGTtAGTC TGgCCaTAGAACGCGC MscI E356Q GGAGAAT GGTgCCAGGGTACATTTcCAATCCGTCA KpnI D372N AATACAT CTTaAGGCCGTCGTtGTCGGTGTGG A II D373N ... [48] and A. nidulans [49], isomaltose and panose are known as effective inducers for amylase synthesis. In the case of A. nidulans, a mylase synthes is...
Ngày tải lên: 19/02/2014, 16:20
Tài liệu Báo cáo khoa học: "Methods for the Qualitative Evaluation of Lexical Association Measures" doc
... percent of the data in the SLs; the lack of significant differences between the AMs after approx. 50% of the data in the SLs have been examined; and the lack of significant differences between the measures ... simple -best approaches are not suitable for a qualitative evaluation of lexi- cal association measures, mainly for the follow- ing reasons: the instab...
Ngày tải lên: 20/02/2014, 18:20
Báo cáo khóa học: Insight into the activation mechanism of Bordetella pertussis adenylate cyclase by calmodulin using fluorescence spectroscopy pptx
... site in both the uncomplexed AC and the AC–CaM complex. Dynamics of the AC catalytic domain as probed by acrylodan Taking advantage of the absence of Cys residues in the native AC protein, the insertion ... difference between AC and AC–CaM is the increased ratio of bound/ free Ant-dATP in the latter as detected by the CaM-induced increase in the relativ...
Ngày tải lên: 07/03/2014, 15:20
Báo cáo khoa học: Bacitracin inhibits the reductive activity of protein disulfide isomerase by disulfide bond formation with free cysteines in the substrate-binding domain pptx
... formation between the Fig. 1. Separation of bacitracin analogs. (A) Structures of the most abundant bacitracin analogs of commercial bacitracin mixtures including the amino-thiazoline ring (a) and ... nm (Fig. 2A E). The kinetics of this reaction were biphasic, with an initial lag phase fol- lowed by an exponential increase in turbidity. In each case, the presence of...
Ngày tải lên: 14/03/2014, 23:20
Báo cáo khoa học: Intrabodies against the EVH1 domain of Wiskott–Aldrich syndrome protein inhibit T cell receptor signaling in transgenic mice T cells potx
... 5¢-CAGAACCACCACCCCCTGAGGAGACGGTGACTGAGG ATCC-3¢; primer 3, 5¢-CACCC AAGCTTGCCACCATGCAGGTTACTCT GAAAGAGTC-3¢; primer 4, 5¢-CACCC AAGCTTGCCACCATGAAATG CAGCTGGGTTATCTTC-3¢; primer 5, 5¢-CAGAACCACCACCCCCTG AGGAGACGGTGACTGAGGTTCC-3¢; ... FEBS (EQKLISEEDL) was generated as follows: coding linker containing a NotI site at the 5¢ end of the linker (5¢-GGC CGCAGGTTCGGAGCAGAAGCTGATCAGCGAGGAG...
Ngày tải lên: 16/03/2014, 14:20
Báo cáo khoa học: Principles behind the multifarious control of signal transduction ERK phosphorylation and kinase/phosphatase control potx
... about the control of intracellular signaling? Its pathways, such as the MAPK cascades, are often composed of kinase and phosphatase pairs. But how important are the kinases and phosphatases relative ... light on the control of kinases and phosphatases on signal transduction [22 ]. For instance, it was predicted that, in a protein kinase signaling pathway, kinases mainly co...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Studies on the regulatory properties of the pterin cofactor and dopamine bound at the active site of human phenylalanine hydroxylase pptx
... the hPAHÆadrenaline/ dopamine binary complex [17] was superimposed onto that of the ligand-free rPAH containing the regulatory and catalytic domains [19] the catecholamine main-chain is also Fig. ... of the full-length wt-hPAH was measured as a function of L-Phe concentration and a steady-state (3 min response) binding isotherm was obtained [26 ,27 ]. The isotherm obs...
Ngày tải lên: 17/03/2014, 09:20