Báo cáo y học: "Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol diet" pptx
Báo cáo y học: "Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat and cholesterol diet" pptx
... murine VCAM-1 and iNOS promoters are activated by AP-1, NFkB, and by STAT1 and its secondary target, inter- feron regulatory factor-1 [12-14,44]. TNFα is a strong acti- vator of AP-1 and NFkB, and ... for citation purposes) Journal of Inflammation Open Access Research Sensitivity of mice to lipopolysaccharide is increased by a high saturated fat an...
Ngày tải lên: 11/08/2014, 08:21
Báo cáo y học: "Modulation of interleukin-1b-induced inflammatory responses by a synthetic cationic innate defence regulator peptide, IDR-1002, in synovial fibroblasts" docx
... Primer IL-1RA ttggaaggctctgaacctca ctgaaggcttgcatcttgct SIGIRR ctcagagccatgccaggt cctcagcacctggtcttca 18sRNA gtaacccgttgaaccccatt ccatccaatcggtagtagcg Turner-Brannen et al. Arthritis Research & Therapy ... the management of inflammatory arthritis and possibly other diseases characterized by chronic inflammation. Materials and methods Cell isolation and culture Synovial tissues w...
Ngày tải lên: 12/08/2014, 17:22
Báo cáo khoa học: Activated transglutaminase from Streptomyces mobaraensis is processed by a tripeptidyl aminopeptidase in the final step pptx
... hydrolyse Ala-Ala-pNA and Ala-pNA (or other chromogenic amino acids) at reason- able rates clearly indicates exclusive cleavage of the anilide bond of Ala-Ala-Val-Ala-pNA. Our results also provide convincing ... Ala-Ala- Val-Ala-pNA or Ala-Pro-pNA, exhibiting precisely the sequence of FRAP-TGase. Yellowing of the Ala-Ala-Val-Ala-pNA solution must be the result of direct cleavage...
Ngày tải lên: 31/03/2014, 07:20
Báo cáo y học: " Perception of urge-to-cough and dyspnea in healthy smokers with decreased cough reflex sensitivity" potx
... urge- to- cough and dyspnea may share common pathways and somatosensory areas [11]. Both the urge -to- cough and dyspnea can arise from stimulation by chemical sub- stances and changes in the mechanical ... dyspnea and the urge -to- cough are the result of sensory activa- tion of subcortical and cortical neural pathways. Some of these pathways are shared across respirator...
Ngày tải lên: 13/08/2014, 10:20
Báo cáo Y học: Complexation of ytterbium to human transferrin and its uptake by K562 cells pot
... lactoferrin with a lanthanide ion (Sm 3+ )at3. 4A ˚ resolution. Acta Crystallogr. D55, 1799–1804. 36. Kitamura, T., Gatmaitan, Z. & Arias, I.M. (1990) Serial quanti- tative image analysis and ... l M . ICP-AES was also used to study the binding ratio of Yb 3+ to apo-Tf. After addition of 2.0 and 2.5 mol equiv of Yb 3+ to apo-Tf, the final ratios of Yb 3+ to Tf, after...
Ngày tải lên: 08/03/2014, 09:20
Báo cáo Y học: Oxidation of propionate to pyruvate in Escherichia coli Involvement of methylcitrate dehydratase and aconitase pot
... Forward primer Acs 5¢- TAATACGACTCACTATAGGGA*5¢-AACACACCATTCCTGCCAAC-3¢ CCACCACAGGTCGCGCC-3¢ AcnB 5¢- TAATACGACTCACTATAGGGA*5¢-CTCACACGCTGCTGATGTTC-3¢ CGTGGTTACGCACTTCACC-3¢ PrpD 5¢- TAATACGACTCACTATAGGGA*5¢-AACATCGGCGCGATGATCC-3¢ TCGCTGCTTCAACTGCCG-3 PrpE ... hydroxy or unsaturated dicarboxylic and tricarboxylic acids such as trans-aconitate, threo-2-methyl- isocitrate and erythro-2-meth...
Ngày tải lên: 17/03/2014, 10:20
Báo cáo Y học: Contribution of Lys276 to the conformational flexibility of the active site of glutamate decarboxylase from Escherichia coli pptx
... concentration of species Aattime0. Gad activity assay Enzyme activity was assayed by quantitating the reaction product, 4-aminobutyrate, by HPLC [24] or using Gabase, a commercial preparation containing ... isoforms, GadA and GadB, 98% identical in amino acid sequence and biochemically indistinguishable [18,19]. Gad catalyses the irreversible a- decarboxylation of L -glutamate...
Ngày tải lên: 31/03/2014, 08:20
Báo cáo y học: "Failure of catecholamines to shift T-cell cytokine responses toward a Th2 profile in patients with rheumatoid arthritis" pdf
... untreated hypertension, therapy with sympathomimetics or sympatholytics, and cancer). Patients were examined by taking history, physical examina- tion, and laboratory findings (erythrocyte sedimentation ... factor for inflammation. Introduction Rheumatoid arthritis (RA) is a chronic inflammatory disease characterised by intense immune activation within the synovial compartment of...
Ngày tải lên: 09/08/2014, 08:22
Báo cáo y học: "Transition of healthy to diseased synovial tissue in rheumatoid arthritis is associated with gain of mesenchymal/fibrotic characteristics" pdf
... 5'-CAGGCGCATGAAGGCAAGTTGGGTAG-3' α-sma 5'-CGTGTTGCCCCTGAAGAGCAT-3' 5'-ACCGCCTGGATAGCCACATACA-3' TLH 5'-TTAAAGGAAAGACACTCCGATCAGAGATGA-3' 5'-AATGTTTCCGGAGTAGGGGAGTCTTTTT-3' β 2 M 5'-TCTTGTACTACACTGAATTCACCCCCACTGA-3' ... 5'-FAM-cgtgccGGCAGCCAGTTTGAATATAATGTTGAAGGAggcacg-DABCYL-3' α-SMA 5'-FAM-cgtcgCCAAGGCCAACCGGGAgAAAAT...
Ngày tải lên: 09/08/2014, 08:23
Báo cáo y học: " Predictors of adherence to antiretroviral therapy among people living with HIV/AIDS in resourcelimited setting of southwest ethiopia" pdf
... CDC stage C patien ts had higher risk of pharmacy non-adherence than a symptomatic patients. When compared with asymptomatic patients, themultivariateanalysisconfirmedamarkedriskof non-adherence ... Bivariate analysi s was done to determine presence of statistically significant association between explanatory variables and the outcome variable. All explanatory variables that were as...
Ngày tải lên: 10/08/2014, 05:21