Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx

... experiments performed in mammalian cells, indicate that the relative transcrip- tional activity of wild type p53 and the tested derivatives is comparable in yeast and in human cells. Since lack of p53 function ... cellu- lar system such as a yeast cell should be suitable to assess DNA-binding and transcriptional activation activity regardless of posttranslationa...

Ngày tải lên: 11/08/2014, 08:20

... CSIC-Universidad de Valladolid, Spain 2 Program of In ammation, In ammatory and Infectious Disease Center, and Program of Signal Transduction, Burnham Institute for Medical Research, La Jolla, CA, USA 3 ... The clone obtained in this assay contained a cDNA sequence present in public databases with the Genbank accession number NM_018992. Next, we tested VHR interaction with KCT...

Ngày tải lên: 07/03/2014, 06:20

... and Pf MQ O (MAL6P1.258) were also ampli- fied using the appropriate primers (Pf LDH: forward 5¢-ATGGCACCAAAAGCAAAAATCG-3¢ and reverse 5¢-AGCTAATGCCTTCATTCTCTTAG-3¢; Pf MQO for- ward 5¢-ATGATATGTGTTAAAAATATTTTG-3¢ ... optimum pH for malate oxidation was highly alkaline (pH 10.2). The saturating concentration for OAA was only 250 l M while for malate it was quite high (20 m M ). Mal...

Ngày tải lên: 16/03/2014, 18:20

... The PARG feature (Gildea and Hockenmaier, 2003) and the argument mapping feature. Removing them has a strong effect on accuracy when labeling treebank parses, as shown in our feature ablation results ... Computational Linguistics, 33(4):493–552. Stephen Clark. 2002. Supertagging for combinatory categorial grammar. In Proceedings of the 6th In- ternational Workshop on Tree Ad...

Ngày tải lên: 17/03/2014, 01:20

... of financing and reg- ulatory change, addressing issues of leadership and organ- izational politics, and ensuring training and data management efforts [45]. Second, some states have undertaken ... at the regulatory and purchasing agency level Regulatory and purchasing agencies form the immediate policy context for organizational activity in mental health, and have a long h...

Ngày tải lên: 11/08/2014, 16:21

... CDC and methadone clin- ics for their assistance in making this study possible. References 1. MAP (Monitoring the AIDS Pandemic): Drug injection and HIV/ AIDS in Asia. Washington: MAP secretariat; ... ZG and JM participated in data analysis and contributed to study design; SL prepared the manuscript and incorporated opinions from all others. Acknowledgements The authors than...

Ngày tải lên: 11/08/2014, 18:20

... TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTTCAAATTGCTTTGGC SGA1_D CAGAGAAACAAGCAAAACAAAAAGCTTTTCTTTTCACTAACGTATATGATGGCAAGACAAAAGATGTT SGA1_R TAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTCTACAAACTCTGTAAAACTT ATH1_suc2 ... GGGACGTCATACGGATAGCCCGCATAGTCAGGAACATCGTATGGGTACATGGGTTTTTTCTCCTTGACG R1_pLC1 TTTAGAATGGCTTTTGAAAAAAATAAAAAAGACAATAAGTTTTATAACCTGAATTCGAGCTCGTTTAAAC PEP4_D CAGAGAAAC...

Ngày tải lên: 18/02/2014, 06:20

... involving one Azo and one DM-azo was maintained at 90 °C for 1 h after trans fi cis isomerization as described above. Then, the template strand was added and annealed at 37 °C for 30 min. Thereafter, ... Then, photoresponsive DNA rich in the cis form was mixed with the template strand and incubated at 37 °C for 30 min in the dark. To achieve cis–trans and trans–cis isomers,...

Ngày tải lên: 15/03/2014, 10:20

... [9]. Platelets also accumulate within atherosclerotic lesions, and can recruit additional platelets to form a thrombus, indicating that the arterial wall can assume both an in ammatory and prothrombogenic ... [12]. Micromolar concentrations of ADP are sufficient to induce human platelet aggregation, and in the coagula- tion cascade, AMP is hydrolyzed to adenosine, which has an impor...

Ngày tải lên: 16/03/2014, 10:20

... Miyazawa K, Tsubouchi H, Naka D, Takahashi K, Okigaki M, Arakaki N, Nakayama H, Hirono S, Sakiy- ama O, Takahashi K et al. (1989) Molecular cloning and sequence analysis of cDNA for human hepatocyte growth ... Technology, Nagatsuta, Midori-ku, Yokohama, Japan 2 Advanced Medical Research Laboratory, Mitsubishi Tanabe Pharma Corporation, Kamoshida-cho, Aoba-ku, Yokohama, Japan Introduction...

Ngày tải lên: 15/02/2014, 01:20