Báo cáo khoa hoc:" The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study" ppsx
Báo cáo khoa hoc:" The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study" ppsx
... TTC CTA ACC TTG TTC 3’ 250 58 KCNE2 .1R 5’ GCC ACG ATG ATG AAA GAG AAC 3’ KCNE2 .2F 5’ GAT GCT GAG AAC TTC TAC TAT G 3’ 300 58 KCNE2 .2R 5’ GTC TGG ACG TCA GAT GTT AG 3’ KCNE3 F 5’ GCT AAG ATT TTA CCT ... been associated with hypo- and hyper-kalemia and paralysis [7], and here it was found in two cases. In one family the mutation was co-inherited with a mutation in troponin T an...
Ngày tải lên: 11/08/2014, 07:21
báo cáo khoa học: " The membrane-spanning 4-domains, subfamily A (MS4A) gene cluster contains a common variant associated with Alzheimer’s disease" potx
... Fuensanta Noguera-Perea 1 , Agustina Legaz-Garc a 1 , Laura Vivancos-Moreau 1 , Juan Velasco 5 , José Miguel Carrasco 5 , Montserrat Alegret 3 , Martirio Antequera-Torres 1 , Salvadora Manzanares 1 , ... suggesting a ro le for the immune system in the pathogenesis of AD. The other genes within the candidate block a re poorly character- ized and it is not easy to delineate...
Ngày tải lên: 11/08/2014, 12:21
Báo cáo khoa học: Phytoene synthase genes in tomato (Solanum lycopersicum L.) – new data on the structures, the deduced amino acid sequences and the expression patterns doc
... RT-PCR Psy1R381 CCTCGATGAATCAAAAAAACGG TaqManPsy1 TCATGGAATCAGTCCGGGAGGGAA Psy2 Psy2F952 AGGCAAGGCTGGAAGATATTTTT EF534738 72 RT-PCR Psy2R1024 GAAACAGTGTCGGATAAAGCTGC TaqManPsy2 ACGGGCGGCCATTTGATATGCTTG Psy1 ... GGCCATTGTTGAAAGAGAGG EF534739 1522 Cloning PSY1Rev1522 TCATGCTTTATCTTTGAAGAGAGG Psy2 PSY2For27 TCTCTACGTGTATCAAAGGTAGTAAGG EF534738 1674 Cloning PSY2Rev1674 TGGCATTTAGAAACTTCATTCA Fig....
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Two CYP17 genes in the South African Angora goat (Capra hircus) – the identification of three genotypes that differ in copy number and steroidogenic output pptx
... (sense) CAATGATGGCATCCTGGAG Real-time CYP17 RP (antisense) GAGGCAGAGGTCACAGTAAT CYP17 sensor probe TTCTGAGCAAGGAAATTCTGTTAGAC-FL CYP17 anchor probe 640-TATTCCCTGCGCTGAAGGTGAGGA-p Real-time 3bHSD LP ... K, Yasuda K, Yanase T, Yamakita N, Sasano H, Nawata H, Inoue M, Fukaya T & Shizuta Y (1996) Mutation of cytochrome P-4501 7a gene (CYP17) in a Japanese patient previously reported as...
Ngày tải lên: 07/03/2014, 06:20
Báo cáo khoa hoc:"SRY-related genes in the genome of the rice field eel (Monopterus albus)" docx
... t at t cact aat ggat gcagtggt t gt t caggcagcaggt gat gtt att aaaagt t act gcat ct gggt t acgcat cagat gt aacct 345 caagaat ct gt ccct gt ccccaaaaat ggcaacaagct at t t t t gt gt gcat caccagact ... gtaccagat ct at acaggat at t at t caaccacat t ct t ct at t ccacacagtt t ct gaat t t gaggtgct t ct gt at t t agt t t t aat t cat gt ct agtt gat t t t a 230 t t ct t act ct acgcaaacaacagt t aat ......
Ngày tải lên: 09/08/2014, 18:21
Tài liệu Báo cáo khoa học: The unique sites in SulA protein preferentially cleaved by ATP-dependent Lon protease from Escherichia coli ppt
... incubation in the presence of ATP and after 3 h of incubation in the absence of ATP w ere also analyze d in the same way. The yields of the fragments were estimated b y amino-acid analyses. The results ... are strategically placed mainly in the central region of SulA so that the cleavage at any of these sites would lead to rapid inactivation of the protein. As for t...
Ngày tải lên: 21/02/2014, 03:20
Báo cáo khoa học: The Vps4 C-terminal helix is a critical determinant for assembly and ATPase activity and has elements conserved in other members of the meiotic clade of AAA ATPases pdf
... remain elusive. Vps4 has an N-terminal microtubule interacting and trafficking domain required for endosome recruitment, an AAA domain containing the ATPase catalytic site and a b domain, and a ... the Arg residues in the SRH (red) and Walker A and B motifs (black) are shown. The colour code for the remainder of the protein is: large AAA subdomain, pink; small AAA subdomain...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: The hepoxilin connection in the epidermis docx
... or a signaling function in differentiation [9], and we are not much further advanced in defining the mechanism today. Genetic analyses of mutant skin phenotypes have paved the way for unraveling ... hepoxilins in maintaining the epidermal water barrier. Whereas mouse eLOX3 has the required activity with fatty acid hydroperoxides, mouse 12R-LOX is very unusual in apparently la...
Ngày tải lên: 07/03/2014, 09:20
Báo cáo khoa học: The Y42H mutation in medium-chain acyl-CoA dehydrogenase, which is prevalent in babies identified by MS/MS-based newborn screening, is temperature sensitiv pptx
... nvestigated, to distinguish b etween a ÔbenignÕ MCAD variant that causes an abnormal acylcar- nitine pattern, but is unlikely to cause disease, and a Ôdisease- causingÕ MCAD variant. Therefore we have ... Using SRCD analysis to study thermal stability of the MCAD variants we show that the secondary structure of MCAD is maintained up to the t emperature where a gross change in t...
Ngày tải lên: 07/03/2014, 16:20
Báo cáo khoa học: " The Signal System in Interlingua — A Factor in Mechanical Translation" potx
... Russian balalaika and a resonant Spanish guitar, and so forth make fascinating material for descriptive and analytical studies in some branch of meta- linguistics. But no fundamental research ... resynthesis in the translator's mind, the translator himself must not be aware of them any more than a healthy diner is aware of what happens to a slice of steak on its way...
Ngày tải lên: 16/03/2014, 19:20