Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt

... expression vector was conceived by cloning in psiSTRIKE the pre-mmu-miR-328 sequence (5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). ... obtained by cloning 1 or 3 copies of the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT (5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3') binding sites...

Ngày tải lên: 11/08/2014, 07:21

13 362 0
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot

... Schirren CA, Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M, Cerny A, Pape GR: Association of hepatitis C virus- specific CD8+ T cells with viral clearance in acute hepatitis C. J Infect Dis ... We describe here the case of a 69 year old man with acute hep- atitis C virus infection who developed propylthiouracil- induced leucocytopenia, followed by cytope...

Ngày tải lên: 11/08/2014, 10:22

3 232 0
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"

... world. Incidence rates across the world fluctuate and are difficult to calculate given the asymptomatic, often latent nature of the disease prior to clinical presentation. Prevalence rates across ... physician should also offer counseling on treatment, reducing alcohol usage and immunization with hepatitis A, hepatitis B, pneumococcal and influenza vaccines. HCV negative perso...

Ngày tải lên: 02/11/2012, 09:56

6 486 0
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx

... resistant to infection, but infectivity was restored in HepG2 cells transfected with CD81 [56]. In contrast to promoting infectivity of HCVpp and HCVcc, the role of CD81 in binding and internalizat- ion ... CD81 by itself was not capable of faci- litating viral entry. However, if the endocytic activity of CD81 was increased by fusing the cytoplasmic domain of the tran...

Ngày tải lên: 19/02/2014, 06:20

15 570 0
Báo cáo khoa học: Fidelity of hepatitis B virus polymerase pptx

Báo cáo khoa học: Fidelity of hepatitis B virus polymerase pptx

... Before measuring the kinetic constants of correct and wrong nucleotide incorporation, a time course study was carried out to decide the time frame during which products accumulated linearly with ... bovine serum albumin and increasing concentrations of single dNTP), and were incubated at 37 C. The reaction was terminated by the addition of EDTA to a final concentration of 50 m M...

Ngày tải lên: 31/03/2014, 01:20

8 411 0
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt

... analysis of categorical factors associated with HIV and hepatitis C virus (HCV) infections among injection drug users in Vinnitsya, Ukraine (Unadjusted odds ratios with 95% confidence interval). (Continued) Table ... comple- mented by a corresponding HCV protocol created by the investigators. A structured interview was then adminis- tered by trained interviewers at the Infect...

Ngày tải lên: 11/08/2014, 18:20

9 331 0
Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx

Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx

... of the CDK activator Cdc25A and cell-cycle arrest by cyto- kine TGF-beta in cells lacking the CDK inhibitor p15. Nature 387, 417–422. 15 Wang Z, Southwick EC, Wang M, Kar S, Rosi KS, Wilcox CS, ... Cancer Therapeutics at The Institute of Cancer Research, Haddow Laboratories, Sutton, UK Cyclin dependent kinase (CDK) 4 ⁄ cyclin D kinase is an important regulator of cell cycle entry...

Ngày tải lên: 18/02/2014, 18:20

11 457 0
Báo cáo khoa học: "Detection of Quotations and Inserted Clauses and its Application to Dependency Structure Analysis in Spontaneous Japanese" doc

Báo cáo khoa học: "Detection of Quotations and Inserted Clauses and its Application to Dependency Structure Analysis in Spontaneous Japanese" doc

... shown in Table 3. Although the accuracy of detecting the boundaries of quotations and inserted clauses us- ing automatically analyzed dependency structure was not high, the accuracy of dependency ... and inserted clauses helped to improve the accuracy of depen- dency structure analysis. 1 Introduction The “Spontaneous Speech: Corpus and Pro- cessing Technology” project sponsored t...

Ngày tải lên: 23/03/2014, 18:20

7 386 0
Báo cáo khoa học: "Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR" ppt

Báo cáo khoa học: "Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR" ppt

... vaccination in all vaccinated dogs. Detection of CDV in clinically affected dogs Of the 51 PBMC samples from dogs with the typical clinical signs of CD, the amplified NP gene was detected in 45 dogs by ... reverse transcription PCR (RT-PCR) com- bined nested PCR was set up to increase efficiency in the diagnosis of canine distemper virus (CDV) infection after developemen...

Ngày tải lên: 07/08/2014, 14:23

5 368 0
Báo cáo khoa học: " Evaluation of partial cranial cruciate ligament rupture with positive contrast computed tomographic arthrography in dogs" ppt

Báo cáo khoa học: " Evaluation of partial cranial cruciate ligament rupture with positive contrast computed tomographic arthrography in dogs" ppt

... arthrography, computed tomography, cruciate ligament, dog, rupture Introduction Most ligament injuries in canine stifle joints involve some kind of cranial cruciate ligament rupture, including partial ... dynamic intra-articular saline injection. The investigators concluded that ultrasonographic examination of stifle joints had potential as a diagnostic tool for assessing cranial...

Ngày tải lên: 07/08/2014, 23:22

6 274 0
w