Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
Báo cáo khoa hoc:" Refractoriness of hepatitis C virus internal ribosome entry site to processing by Dicer in vivo" ppt
... expression vector was conceived by
cloning in psiSTRIKE the pre-mmu-miR-328 sequence
(5'accgtggagtgggggggcaggaggggctcagggagaaagtgcatacagccc
ctggccctctctgcccttccgtcccctgt ttttc-3') (Promega). ... obtained by cloning 1 or 3 copies of
the PC (5'-atctcaacggaagggcagagagggccagatctc-3') or WT
(5'-atctcgtccctgtggtaccctggcagagaaagggccaatctcaatctc-3')
binding sites...
Báo cáo khoa hoc:" Recurrence of hepatitis C virus during leucocytopenia and spontaneous clearance after recovery from cytopenia: a case report" pot
... Schirren CA,
Schraut WW, Hoffmann R, Zachoval R, Santantonio T, Cucchiarini M,
Cerny A, Pape GR: Association of hepatitis C virus- specific
CD8+ T cells with viral clearance in acute hepatitis C. J Infect
Dis ... We
describe here the case of a 69 year old man with acute hep-
atitis C virus infection who developed propylthiouracil-
induced leucocytopenia, followed by cytope...
Báo cáo y học: "Epidemiology of Hepatitis C Virus (HCV) Infection"
... world. Incidence rates across the world fluctuate and are
difficult to calculate given the asymptomatic, often latent nature of the disease prior to clinical presentation. Prevalence
rates across ... physician should also offer
counseling on treatment, reducing alcohol usage and
immunization with hepatitis A, hepatitis B,
pneumococcal and influenza vaccines. HCV negative
perso...
Tài liệu Báo cáo khoa học: How does hepatitis C virus enter cells? pptx
... resistant to infection, but
infectivity was restored in HepG2 cells transfected with
CD81 [56].
In contrast to promoting infectivity of HCVpp and
HCVcc, the role of CD81 in binding and internalizat-
ion ... CD81 by itself was not capable of faci-
litating viral entry. However, if the endocytic activity
of CD81 was increased by fusing the cytoplasmic
domain of the tran...
Báo cáo khoa học: Fidelity of hepatitis B virus polymerase pptx
... Before
measuring the kinetic constants of correct and wrong
nucleotide incorporation, a time course study was carried
out to decide the time frame during which products
accumulated linearly with ... bovine serum albumin and increasing
concentrations of single dNTP), and were incubated at
37 C. The reaction was terminated by the addition of
EDTA to a final concentration of 50 m
M...
báo cáo khoa học: " HIV and hepatitis C virus infections among hanka injection drug users in central Ukraine: a cross-sectional survey" ppt
... analysis of categorical factors associated with HIV and hepatitis C virus (HCV) infections among injection drug
users in Vinnitsya, Ukraine (Unadjusted odds ratios with 95% confidence interval). (Continued)
Table ... comple-
mented by a corresponding HCV protocol created by the
investigators. A structured interview was then adminis-
tered by trained interviewers at the Infect...
Tài liệu Báo cáo khoa học: Phosphorylation of cyclin dependent kinase 4 on tyrosine 17 is mediated by Src family kinases pptx
... of the
CDK activator Cdc25A and cell-cycle arrest by cyto-
kine TGF-beta in cells lacking the CDK inhibitor p15.
Nature 387, 417–422.
15 Wang Z, Southwick EC, Wang M, Kar S, Rosi KS,
Wilcox CS, ... Cancer Therapeutics at The Institute of Cancer Research, Haddow Laboratories, Sutton, UK
Cyclin dependent kinase (CDK) 4 ⁄ cyclin D kinase is
an important regulator of cell cycle entry...
Báo cáo khoa học: "Detection of Quotations and Inserted Clauses and its Application to Dependency Structure Analysis in Spontaneous Japanese" doc
... shown
in Table 3. Although the accuracy of detecting the
boundaries of quotations and inserted clauses us-
ing automatically analyzed dependency structure
was not high, the accuracy of dependency ... and inserted clauses
helped to improve the accuracy of depen-
dency structure analysis.
1 Introduction
The “Spontaneous Speech: Corpus and Pro-
cessing Technology” project sponsored t...
Báo cáo khoa học: "Detection of canine distemper virus (CDV) through one step RT-PCR combined with nested PCR" ppt
... vaccination in all vaccinated dogs.
Detection of CDV in clinically affected dogs
Of the 51 PBMC samples from dogs with the typical
clinical signs of CD, the amplified NP gene was detected
in 45 dogs by ... reverse transcription PCR (RT-PCR) com-
bined nested PCR was set up to increase efficiency in the
diagnosis of canine distemper virus (CDV) infection after
developemen...
Báo cáo khoa học: " Evaluation of partial cranial cruciate ligament rupture with positive contrast computed tomographic arthrography in dogs" ppt
... arthrography, computed tomography, cruciate ligament,
dog, rupture
Introduction
Most ligament injuries in canine stifle joints involve some
kind of cranial cruciate ligament rupture, including partial ... dynamic
intra-articular saline injection. The investigators concluded
that ultrasonographic examination of stifle joints had
potential as a diagnostic tool for assessing cranial...