Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf

Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf

Báo cáo khoa hoc:" Divine intervention? A Cochrane review on intercessory prayer gone beyond science and reason" pdf

... Central Page 1 of 4 (page number not for citation purposes) Journal of Negative Results in BioMedicine Open Access Commentary Divine intervention? A Cochrane review on intercessory prayer gone beyond ... the causal mecha- nism? The authors provide no explanation, and it is hard to imagine how prayer for ill people located at the other side of the globe [2], and who...

Ngày tải lên: 11/08/2014, 07:21

4 207 0
Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx

Tài liệu Báo cáo khoa học: "Generating with a Grammar Based on Tree Descriptions: a Constraint-Based Approach" pptx

... sup- port both a more precise formulation of grammars and a different perspective on the mathematical and computational properties of natural language. But eventually the question must also be ad- dressed ... based on an axiomatic rather than a gen- erative view of grammar, (ii) it uses a TAG-like grammar in which the basic linguistic units are trees rather than categories an...

Ngày tải lên: 20/02/2014, 18:20

8 397 0
Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

Báo cáo khoa học: DmGEN shows a flap endonuclease activity, cleaving the blocked-flap structure and model replication fork docx

... (5¢-to3¢) A GGCTGCAGGTCGAC B CAGCAACGCAAGCTTG C GTCGACCTGCAGCCCAAGCTTGCGTTGCTG A- flap ATGTGGAAAATCTCTAGCAGGCTGCAGGTC GAC B-flap CAGCAACGCAAGCTTGATGTGGAAAATCTCT AGCA B-g1 CAGCAACGCAAGCTT B-g2 CAGCAACGCAAGCT B-g4 ... CAGCAACGCAAGCT B-g4 CAGCAACGCAAG A- b15 AGAGATTTTCCACAT A- b17 CTAGAGATTTTCCACAT A- b19 TGCTAGAGATTTTCCACAT D TGACAAGGATGGCTGGTGGGACTTAGCGTA E TACGCTAAGTCCCACCAGCCATCCTTGTCA F...

Ngày tải lên: 07/03/2014, 10:20

14 433 0
Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx

Báo cáo khoa học: DYNLL/LC8: a light chain subunit of the dynein motor complex and beyond pptx

... e2524. 60 Aranda B, Achuthan P, Alam-Faruque Y, Armean I, Bridge A, Derow C, Feuermann M, Ghanbarian AT, Kerrien S, Khadake J et al. (2010) The IntAct molecu- lar interaction database in 2010. ... 1A, B): two-five-stranded, antiparallel b-sheets are responsible for dimerization; each b-sheet contains four strands from one monomer and a fifth strand from the other monomer. These sheets are...

Ngày tải lên: 14/03/2014, 22:20

17 573 0
Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

Báo cáo khoa học: Effects of a tryptophanyl substitution on the structure and antimicrobial activity of C-terminally truncated gaegurin 4 doc

... spectra of the GGN4 analogues, including the native GGN4, showed a strong negative band near 200 nm and a weak and broad band around 222 nm, indicating a predominantly random-coil conformation with ... spectra changed dramatically, with a strong positive band near 192 nm and strong negative bands centered at 208 and 222 nm, which are indicative of a highly a helical confor...

Ngày tải lên: 31/03/2014, 09:20

8 447 0
Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx

Báo cáo khoa hoc:" CP-31398, a putative p53-stabilizing molecule tested in mammalian cells and in yeast for its effects on p53 transcriptional activity" potx

... bacterial lacZ gene allows verification and quantitation of the transcrip- tional activity of the various p53 forms and putative modulators. Transformation of this strain with an episomal plasmid expressing ... system such as a yeast cell should be suitable to assess DNA-binding and transcriptional activation activity regardless of posttranslational modifications and other influence...

Ngày tải lên: 11/08/2014, 08:20

9 485 0
Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx

Báo cáo khoa học: " Is there a special mechanism behind the changes in somatic cell and polymorphonuclear leukocyte counts, and composition of milk after a single prolonged milking interval in cows" pptx

... the afternoon milkings, at days -1 and 1 from all cows. At days 3 and 5 casein and FFA was analysed in milk only from cows which during day 1 had a pronounced reaction with SCC that was increased ... PMI to 1.52 day 1 (p Acta Veterinaria Scandinavica 2009, 51:4 http://www.actavetscand.com/content/51/1/4 Page 3 of 10 (page number not for citation purposes) lactation and in lactation...

Ngày tải lên: 12/08/2014, 18:22

10 397 0
Báo cáo khóa học: Human PABP binds AU-rich RNA via RNA-binding domains 3 and 4 pdf

Báo cáo khóa học: Human PABP binds AU-rich RNA via RNA-binding domains 3 and 4 pdf

... Matthias Goerlach and Gideon Dreyfuss for providing PABP cDNA, Tullia Lindsten for iPABP cDNA and Gideon Dreyfuss for PABP mAb. This work was supported by a program grant from the National Health and ... D. & Jacobson, A. (1990) mRNA poly (A) tail, a- 3¢ enhancer of translational initiation. Mol. Cell Biol. 10, 3441–3455. 18. Uchida, N., Hoshino, S., Imataka, H., Sonenberg, N. &...

Ngày tải lên: 23/03/2014, 12:20

8 307 0
Báo cáo khoa học: "Unsupervised Induction of Modern Standard Arabic Verb Classes Using Syntactic Frames and LSA" pdf

Báo cáo khoa học: "Unsupervised Induction of Modern Standard Arabic Verb Classes Using Syntactic Frames and LSA" pdf

... for Arabic. Instead we rely on an approximation that takes advantage of two gen- eralizations from linguistics: the animacy hierar- chy and zero-anaphora. According to the animacy hierarchy, as ... such as Infor- mation Extraction, Event Detection, Information Retrieval and Word Sense Disambiguation, not to mention the facilitation of lexical resource cre- ation such as MSA WordNets an...

Ngày tải lên: 31/03/2014, 01:20

8 352 0
Báo cáo khoa học: " Influence of different treatment techniques on radiation dose to the LAD coronary artery" pdf

Báo cáo khoa học: " Influence of different treatment techniques on radiation dose to the LAD coronary artery" pdf

... plans and performed data acquisition. CN and SS performed data analysis and interpretation and drafted the manuscript. All authors read and approved the final manuscript. References 1. Chandra ... than conventional radiation treatment and three-dimensional conformal radio- therapy for mediastinal masses in patients with Hodgkin's dis- ease, and is there a role for beam or...

Ngày tải lên: 09/08/2014, 10:21

7 455 0
w