báo cáo khoa học: " Peer chart audits: A tool to meet Accred

báo cáo khoa học: " Peer chart audits: A tool to meet Accreditation Council on Graduate Medical Education (ACGME) competency in practicebased learning and improvement" docx

... A Estrada - cestrada@uab.edu * Corresponding author †Equal contributors Abstract Background: The Accreditation Council on Graduate Medical Education (ACGME) supports chart audit as a method to ... designs and statistical methods to appraisal of clinical studies and other information on diagnostics and 5) use information technology to manage information a...

Ngày tải lên : 11/08/2014, 05:22

5
210
0

Tài liệu Báo cáo khoa học: Control analysis as a tool to understand the formation of the las operon in Lactococcus lactis doc

... CP-pyk (5¢-ACGACTAGTGGATCCATNNNNNAGTTTATTCTT GACANNNNNNNNNNNNNNTGRTATAATNNNNAA GTAATAAAATATTCGGAGGAATTTTGAAATGAATA AACGTGTAAAAATCG-3¢)(N¼ A, T, G, C) and pyk- back (5¢-CTCTACATGCATTTCAACAATAGGGCCTG TC-3¢) for ampliﬁcation of pyk. The resulting PCR prod- ucts, ... PK activity was modulated. At increased PK activity we found an almost proportional increase in formate and acetate producti...

Ngày tải lên : 19/02/2014, 17:20

12
616
0

Báo cáo khoa học: "Hyperglycaemic index as a tool to assess glucose control: a retrospective study" docx

... a protocol that aimed to achieve normoglycaemia. Thus, the logical aims of glucose control are to eliminate hyper- glycaemia as rapidly as possible and to maintain normoglycaemia from then onward, ... Implementation of a safe and effective insulin infusion protocol in a medical intensive care unit. Diabetes Care 2004, 27:461-467. 31. Vincent JL, Moreno R, Takala J, Wil...

Ngày tải lên : 12/08/2014, 20:20

6
264
0

Tài liệu Báo cáo khoa học: Pharmacologic chaperoning as a strategy to treat Gaucher disease ppt

... lysosomal concentration of partially active GC vari- ants, as demonstrated by increased cellular GC activity, an increased concentration of lysosomal GC glyco- forms and increased colocalization of ... lysosomal concentration, in which case new dosing and washout regimens may be useful in restoring partial L444P GC activity. Lastly, in contrast to ERT and like substrate reduc- t...

Ngày tải lên : 18/02/2014, 16:20

7
507
0

Tài liệu Báo cáo khoa học: Phage-display as a tool for quantifying protein stability determinants pptx

... binding partner (stability- or afﬁnity-based), one could divide a phage library in half and sort one half against a binding partner and the other half against an expression tag. A comparison of ... research- ers have increasingly been using selection and screening methods to investigate protein stability. In comparison to the labor-intensive process of generating and cha...

Ngày tải lên : 19/02/2014, 12:20

7
502
0

Tài liệu Báo cáo khoa học: Infrared spectroscopy as a tool for discrimination between sensitive and multiresistant K562 cells doc

... line A and cell line B. The trainin g set was the only one used for model calculations (PCA, genetic algorithm and LDA). Data reduction by principal component analysis (PCA). IR spectra are samples ... discriminant analysis (LDA).Thisstatistical multivariate method is supervised. It searches for the variables containing the greatest interclass variance and the smallest intraclass vari...

Ngày tải lên : 21/02/2014, 03:20

6
555
0

Tài liệu Báo cáo khoa học: "Finite Structure Query: A Tool for Querying Syntactically Annotated Corpora" doc

... Plaehn and Thorsten Brants. 2000. Annotate - an efficient interactive annotation tool. In Sixth Conference on Applied Natural Language Process- ing (ANLP-2000). Beth Randall. 2000. CorpusSearch ... be a tree, and X be a set of variables. A variable assignment a : X N is a function that assigns a node from N to each variable. Let a be a variable assignment. T...

Ngày tải lên : 22/02/2014, 02:20

8
375
0

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed " docx

... in analysis of the value chain, industrial organisation, and production economics • Training workshops at IPSARD on survey and data collection techniques; and market analysis, including value ... supply chain for animal feeds in Vietnam Secondary data are relevant and available It has become apparent that available secondary data is not enough to provide a quanti...

Ngày tải lên : 21/06/2014, 04:20

19
497
1

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Milestone 4 " ppt

... protein content too low, inaccurate labeling, high mycotoxins, feed stored in areas with high contamination risk. • MARD experts said that the quality of feed analysis from laboratories in Vietnam ... some large companies have a selling strategy concentrated at large agents, and not much to smaller agents operating in remote areas. This avoids payment risk with farmers as the...

Ngày tải lên : 21/06/2014, 04:20

5
533
0

Báo cáo khoa học nông nghiệp " Developing a strategy for enhancing the competitiveness of rural small and medium enterprises in the agro-food chain: the case of animal feed - Use of Industrial and Mixed Feed by Livestock Producers in Vietnam " doc

... of Agriculture and Rural Development and provincial Departments, relevant staff of the National Institutes of Animal Husbandry and Veterinary Research, Vietnam Animal Feed Association. Purpose ... material inputs, and lack of capacity to implement quality control. Policy approaches needed to address constraints are addressed in a separate Policy Brief: “Constraints...

Ngày tải lên : 21/06/2014, 05:20

27
536
0