báo cáo khoa học: " Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for acute stroke care" doc

... purposes) Implementation Science Open Access Research article Assessing organisational readiness for change: use of diagnostic analysis prior to the implementation of a multidisciplinary assessment for ... approach for diagnostic analysis. The combination of qualitative and quantitative data were able to capture multiple perspectives on barrier...

Ngày tải lên: 11/08/2014, 05:22

... r elated measurement tools synthesized in a concept map; a set of core mea- sures for assessing OR for KT that will be available in a database and a searchable website; and a validated OR for ... of Political Science, Université Laval, Québec, Canada. 5 Faculty of Nursing, University of Alberta, Edmonton, Alberta, Canada. 6 Ottawa Hospital Research Institute, Ottawa,...

Ngày tải lên: 10/08/2014, 11:20

... the performance of the simple RF estimator against the discounted RF estimator. Furthermore, we want to study the contribution of generalized fragments to the parse accuracy. We therefore created for each ... representation for utterance analyses, • a set of decomposition operations that divide a given utterance analysis into a set of fragments, Note that th...

Ngày tải lên: 20/02/2014, 18:20

... Hospital, Nagoya, Japan, 3 Nagoya Radiosurgery Center, Nagoya Kyoritsu Hospital, Nagoya, Japan and 4 Department of Radiation Therapy, Aizawa Hospital, Matsumoto, Japan Email: Fumiya Baba* - fbaba@bd5.so-net.ne.jp; ... 2008, 70:1229-1238. 22. Sasai K, Ono K, Hiraoka M, Tsutsui K, Shibamoto Y, Takahashi M, Hamakawa J, Nadai C, Abe M: The effect of arterial oxygen con- tent on the resu...

Ngày tải lên: 09/08/2014, 09:22

... gene. ACCGTTATCATCGACGACCGTTACGAATCTCTGAAAAACCTGATCACCCTGCGTGCGGACCGTCTGGAAATGATTATCAACGACAACGTTTCTACCATCCTGGCGTCAATT Z. Yuchi et al. RHCC domain imparts extreme thermostability to the KcsA channel FEBS Journal 276 ... interdomain flexibility is another reason for the scarcity of structural data, because of their negative effects on the diffraction qual- ity of protein crystals...

Ngày tải lên: 16/03/2014, 00:20

... 5'-CATCTTCTCAAAATTCGAG-3' Antisense 5'-TGGGAGTAGACAAGGTACAACCC-3' Mouse IL-1β Sense 5'-CAACCAACAAGTGATATTCTCCATG-3' Antisense 5'-GATCCACACTCTCCAGCTGCA-3' Mouse ... 5'-GTCTCCTACCAGACCAAG-3' Antisense 5'-CAAAGTAGACCTGCCCAGACTC-3' Human β-actin Sense 5'-TTCCTGGGCATGGAGTCCT-3' Antisense 5'-AGGAGGAGCAATGATCTTGATC-3' Mo...

Ngày tải lên: 09/08/2014, 08:23

... were automatically determined and then all plots were manually verified. Ambiguous calls were given an N in the data to indicate that no SNP was reliably determined. To assess the accuracy and ... base calls for all SNPs, determined standard genetic statistics such as j ST or j PT values and analyses of mole cular va riance (AMOVA) [41] and exported formatted data for subse- que...

Ngày tải lên: 12/08/2014, 03:21

... provides a clear explanation for the inability of P450scc to cleave the side chain of vitamin D3. Hydroxylation of the side chain of cholesterol at the adjacent carbons C22 and C20, to produce 2 0a, 22R-dihydroxycholesterol ... which they arose by the action of P450scc, as well as the products that they gave rise to. This revealed both the major and minor pat...

Ngày tải lên: 18/02/2014, 17:20

... 2007. Bilingual LSA-based adaptation for statistical machine translation. Machine Translation, pages 187-207. Nicola Ueffing, Gholamreza Haffari and Anoop Sarkar. 2008. Semi-supervised Model Adaptation for ... sentences. When the translated texts and the training data come from the same domain, SMT systems can achieve good performance, otherwise the translation quality degrades dra...

Ngày tải lên: 19/02/2014, 19:20

... 90% of the dataset us- ing PATGEN, and then hyphenate the remaining 10% of the dataset using Liang’s algorithm and the learned pattern file. The PATGEN tool has many user-settable pa- rameters. As ... all paths that do have a hyphen at this position, divided by the sum of the weights of all paths. The forward-backward algorithm uses the sum operator to compute th...

Ngày tải lên: 20/02/2014, 04:20