báo cáo khoa học: " Are we under-utilizing the talents of primary care personnel? A job analytic examination" ppt

báo cáo khoa học: " Are we under-utilizing the talents of primary care personnel? A job analytic examination" ppt

báo cáo khoa học: " Are we under-utilizing the talents of primary care personnel? A job analytic examination" ppt

... comparisons To test the assumption that primary care work was invari- ant across facilities, we compared the number of tasks shared by pairs of facilities. We found a high percentage of overlap among ... to the primary care task bank (e.g., activities such fundraising, developing of edu- cational materials formed part of the family planning task bank but not t...

Ngày tải lên: 11/08/2014, 05:22

13 210 0
Báo cáo khoa học: "Volume, outcome, and the organization of intensive care" pdf

Báo cáo khoa học: "Volume, outcome, and the organization of intensive care" pdf

... mortality. Of all the potential factors examined, the only other organizational characteristic associated with the outcome of patients with sepsis was the presence of a medium care unit, a finding that may ... experience, then perhaps the best solution is to regionalize critical care in a manner similar to that for trauma or neonatal care [10]. Regionalization offe...

Ngày tải lên: 13/08/2014, 03:20

2 179 0
Báo cáo y học: "Capacity utilization and the cost of primary care visits: Implications for the costs of scaling up health interventions" pdf

Báo cáo y học: "Capacity utilization and the cost of primary care visits: Implications for the costs of scaling up health interventions" pdf

... Department of Health and Aged Care: Medicare benefits schedule (1 Novemmber 2002). Health Access and Financing Division, Commonwealth Department of Health and Aged Care. Canberra, ACT, Australia, ... and processing the unit cost data nec- essary for this exercise; to Mahmoud L. Salem, Bian Ying, Viroj Tangcha- roensathien, Walaiporn Patcharanarumol, Jiangbo Bao, Aparnaa Somanathan, E...

Ngày tải lên: 13/08/2014, 11:22

9 495 0
Báo cáo khoa học: "Should we Translate the Documents or the Queries in Cross-language Information Retrieval?" ppt

Báo cáo khoa học: "Should we Translate the Documents or the Queries in Cross-language Information Retrieval?" ppt

... FqEd. We further em- phasize that both translation systems were built from the same training data, and thus are as close to identical quality as can likely be attained. Note also that the results ... comparative study of document translation and query translation of which we are aware; furthermore we have contrasted query and document translation systems on both dire...

Ngày tải lên: 17/03/2014, 07:20

7 382 0
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf

... 5′3′ CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA ACAAUGUGAAA GCAAUGUGAUA 5′ 3′ UAAAUGUGAAU ACUAAGAGUAA GCAAUGUGAUA IL6R mRNA mut 1 5′ 3′ UAAAUGUGAAU ACAAUGUGAAA GCUAAGAGUUA IL6R mRNA mut 3 IL6R mRNA mut 2 miR-2 3a miR-2 3a miR-2 3a 2531 ... 5′3′ 3′ UAUAAGAGUAU CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA CCUUUAGGGACCGUUACACUA 3′ 5′ 3′ 5′ 5′3′ CCUUUAGGGACC...

Ngày tải lên: 18/02/2014, 04:20

9 541 0
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf

... incubation with cofilin at pH 8.0 the rate and the extent of actin cleavage was the same in the presence and absence of 30 mm Pi. On the other hand, at pH 6.5 the rate of F-actin cleavage was inhibited ... vicinity of the barbed end of the filament, pro- ducing an ATP or ADP–Pi cap at this end. Because of the presence of this cap at the barbed end the critica...

Ngày tải lên: 19/02/2014, 07:20

9 488 0
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc

... AO and SsaDH-coupled enzyme assay. (A) The NADPH pro- duction in the assay was determined with the additions as indicat- ed. The presence of AO, SsaDH and CH 3 -4-aminobutyrate as substrate were ... Lustig A, Edmondson DE & Mattevi A (2005) Three-dimensional structure of human monoamine oxidase A (MAO A) : relation to the structures of rat MAOA and human MAOB. Proc N...

Ngày tải lên: 19/02/2014, 07:20

9 525 0
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf

... USA 1 . Polyclonal and monoclonal antibodies against the various subunits of the yeast cytochrome bc 1 complex were prepared in the Trumpower laboratory. The anti-Tom40 Igs were a gift of N. Pfanner 2 (Institute ... 1211 Interestingly, the absence of subunit 6 also resulted in an increase in the ratio of intermediate to mature cyto- chrome c 1 and a disappearance of...

Ngày tải lên: 19/02/2014, 12:20

10 518 0
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf

... use of animals complied with the ARVO Statement for the Use of Animals in Ophthalmic and Vision Research and the Intramural Animal Care and Use program of the National Institutes of Health (NIH). G. ... Hngtrap1, ATGAACCGA GTGAACTCCATCCAC; Hngtrap2, ACTTCTTCCGCTG GAACAGCCACA. The resultant clones were sequenced in-house, using the CEQ2000 system (Beckman Coulter, Fullert...

Ngày tải lên: 19/02/2014, 17:20

16 561 0
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx

... as the relative mRNA/b-actin mRNA ratio. The mRNA/b-actin mRNA ratio of the time standards (pools) cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Data are therefore expressed as relative values ... alpha I Sense: 5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢ Antisense: 5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢ Mouse (gi:6754969) prolylhydroxylase alpha II Sense: 5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢ Antisens...

Ngày tải lên: 20/02/2014, 02:21

8 434 0
Từ khóa:
w