báo cáo khoa học: " Are we under-utilizing the talents of primary care personnel? A job analytic examination" ppt
báo cáo khoa học: " Are we under-utilizing the talents of primary care personnel? A job analytic examination" ppt
... comparisons
To test the assumption that primary care work was invari-
ant across facilities, we compared the number of tasks
shared by pairs of facilities. We found a high percentage of
overlap among ... to the primary care task
bank (e.g., activities such fundraising, developing of edu-
cational materials formed part of the family planning task
bank but not t...
Báo cáo khoa học: "Volume, outcome, and the organization of intensive care" pdf
... mortality. Of all
the potential factors examined, the only other organizational
characteristic associated with the outcome of patients with
sepsis was the presence of a medium care unit, a finding that
may ... experience, then perhaps
the best solution is to regionalize critical care in a manner
similar to that for trauma or neonatal care [10].
Regionalization offe...
Báo cáo y học: "Capacity utilization and the cost of primary care visits: Implications for the costs of scaling up health interventions" pdf
... Department of Health and Aged Care: Medicare
benefits schedule (1 Novemmber 2002). Health Access and
Financing Division, Commonwealth Department of Health
and Aged Care. Canberra, ACT, Australia, ... and processing the unit cost data nec-
essary for this exercise; to Mahmoud L. Salem, Bian Ying, Viroj Tangcha-
roensathien, Walaiporn Patcharanarumol, Jiangbo Bao, Aparnaa
Somanathan, E...
Báo cáo khoa học: "Should we Translate the Documents or the Queries in Cross-language Information Retrieval?" ppt
...
FqEd.
We further em-
phasize that both translation systems were
built from the same training data, and thus
are as close to identical quality as can likely
be attained. Note also that the results ...
comparative study of document translation
and query translation of which we are aware;
furthermore we have contrasted query and
document translation systems on both dire...
Tài liệu Báo cáo khoa học: MicroRNA-23a promotes the growth of gastric adenocarcinoma cell line MGC803 and downregulates interleukin-6 receptor pdf
... 5′3′
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
ACAAUGUGAAA
GCAAUGUGAUA
5′
3′
UAAAUGUGAAU
ACUAAGAGUAA
GCAAUGUGAUA
IL6R mRNA mut 1
5′
3′
UAAAUGUGAAU
ACAAUGUGAAA GCUAAGAGUUA
IL6R mRNA mut 3
IL6R mRNA mut 2
miR-2 3a
miR-2 3a
miR-2 3a
2531 ... 5′3′
3′
UAUAAGAGUAU
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
CCUUUAGGGACCGUUACACUA
3′ 5′ 3′ 5′ 5′3′
CCUUUAGGGACC...
Tài liệu Báo cáo khoa học: Inorganic phosphate regulates the binding of cofilin to actin filaments pdf
... incubation with cofilin at pH 8.0 the rate and
the extent of actin cleavage was the same in the
presence and absence of 30 mm Pi. On the other
hand, at pH 6.5 the rate of F-actin cleavage was
inhibited ... vicinity of the barbed end of the filament, pro-
ducing an ATP or ADP–Pi cap at this end. Because of
the presence of this cap at the barbed end the critica...
Tài liệu Báo cáo khoa học: Final steps in the catabolism of nicotine Deamination versus demethylation of c-N-methylaminobutyrate doc
... AO and SsaDH-coupled enzyme assay. (A) The NADPH pro-
duction in the assay was determined with the additions as indicat-
ed. The presence of AO, SsaDH and CH
3
-4-aminobutyrate as
substrate were ... Lustig A, Edmondson
DE & Mattevi A (2005) Three-dimensional structure of
human monoamine oxidase A (MAO A) : relation to the
structures of rat MAOA and human MAOB. Proc N...
Tài liệu Báo cáo khóa học: Further insights into the assembly of the yeast cytochrome bc1 complex based on analysis of single and double deletion mutants lacking supernumerary subunits and cytochrome b pdf
... USA
1
.
Polyclonal and monoclonal antibodies against the various
subunits of the yeast cytochrome bc
1
complex were
prepared in the Trumpower laboratory. The anti-Tom40
Igs were a gift of N. Pfanner
2
(Institute ... 1211
Interestingly, the absence of subunit 6 also resulted in an
increase in the ratio of intermediate to mature cyto-
chrome c
1
and a disappearance of...
Tài liệu Báo cáo khoa học: cN-crystallin and the evolution of the bc-crystallin superfamily in vertebrates pdf
... use of animals complied with the ARVO Statement
for the Use of Animals in Ophthalmic and Vision Research
and the Intramural Animal Care and Use program of the
National Institutes of Health (NIH).
G. ... Hngtrap1, ATGAACCGA
GTGAACTCCATCCAC; Hngtrap2, ACTTCTTCCGCTG
GAACAGCCACA. The resultant clones were sequenced
in-house, using the CEQ2000 system (Beckman Coulter,
Fullert...
Tài liệu Báo cáo khoa học: Oxygen tension regulates the expression of a group of procollagen hydroxylases docx
... as the relative mRNA/b-actin mRNA ratio. The
mRNA/b-actin mRNA ratio of the time standards (pools)
cDNA was set to 1.0 (i.e. normoxia, 21% oxygen). Data
are therefore expressed as relative values ... alpha I
Sense:
5¢-CGGGATCCTCGGACACCCTGTAAATG-3¢
Antisense:
5¢-GGAATTCCAAGCAGTCCTCAGCTGT-3¢
Mouse (gi:6754969) prolylhydroxylase alpha II
Sense:
5¢-CGGGATCCTGCAGGCAGAATTCTTCA-3¢
Antisens...
Từ khóa: