Báo cáo y học: "Specifying and reporting complex behaviour change interventions: the need for a scientific method" potx
Báo cáo y học: "Specifying and reporting complex behaviour change interventions: the need for a scientific method" potx
... terminology that
limits meta-analyses and contributions to science. For
example, 'behavioural counselling', 'academic detailing',
and 'outreach' can mean very different ... a
detailed manual was available), only a few investigators
actually measured the presence or strength of the interven-
tion in practice, and fewer still included such measures...
báo cáo khoa học: " Specifying and reporting complex behaviour change interventions: the need for a scientific method" pot
... in the intervention, and 3) the causal processes tar-
geted by these change techniques; all in as much detail as
is possible, unless these details are already readily availa-
ble (e.g., in a prior ... Having consistent terminol-
ogy and sufficient information for replication appears to
be more problematic for behavioural and organisational
interventions than for pharmacolo...
Báo cáo y học: "Hyperuricemia and cardiovascular disease: how strong is the evidence for a causal link" docx
... pro-
vides an antioxidant defense in humans against oxidant- and
radical-caused aging and cancer: a hypothesis. Proc Natl Acad
Sci U S A 1981, 78:6858-6862.
51. Sanchez-Lozada LG, Tapia E, Bautista-Garcia ... colleagues [10], by Baker and colleagues [11], and
by Edwards [12].
Serum urate and vascular effects in
laboratory and animal studies
Using a rat animal model in which...
Báo cáo y học: " Repetition and severity of suicide attempts across the life cycle: a comparison by age group between suicide victims and controls with severe depression" ppsx
... Australia. Aust N Z J Psychiatry 2004, 38:520-525.
31. Buckley NA, Dawson AH, Whyte IM, Hazell P, Meza A, Britt H:
An
analysis of age and gender influences on the relative risk for
suicide and ... suicide and psy-
chiatric consultation: risk factors and suicide mortality dur-
ing a five-year follow-up. Acta Psychiatr Scand 1991, 84:545-549.
27. Hawton K, Fagg J: Suicide, and...
Báo cáo y học: " Facilitators and obstacles in pre-hospital medical response to earthquakes: a qualitative study"
... Tsunami in Thailand and Indonesia [27,43], the
Chi-Chi earthquake in Taiwan [16,39] and the Gujarat
earthquake in India [44].
As demonstrated, the army plays an important part in
the early response ... evacuated mainly by air.
It was the air force’s responsibility, along with the air
transport organization, to provide the evacuation by air.
In addition they carried managers,...
Báo cáo Y học: Cloning and expression of two novel aldo-keto reductases from Digitalis purpurea leaves potx
... immediately
immersedinliquidnitrogen.
Nucleic acid isolation and analysis
For Northern analyses, 20 lg total RNA were separated on
1.2% formaldehyde–agarose gels and then capillary trans-
ferred to a Hybond-N
+
membrane (Amersham Pharmacia
Biotech) ... within a closely related AKR family.
Sequences aligned are DpAR1 and DpAR2,
D. purpurea (this study); AAC23647,
AAD32792, CAB88350...
Báo cáo Y học: Structural and compositional changes in very low density lipoprotein triacylglycerols during basal lipolysis potx
... diacylglycerols from plasma VLDL triacylglycerols. NEU derivatives of diacylglycerols were prepared
after partial deacylation of plasma VLDL triacylglycerols and they were separated and analysed ... stereochemical incompatibility. Other hypotheses could be
advanced about a preferential release of the saturated and
monounsaturated fatty acids for the purposes of oxidation as
well...
Báo cáo y học: "Suicidality and depression among adult patients admitted in general medical facilities in Kenya" potx
... clearly demonstrate the need for appropri-
ate practices and policies to increase awareness of, and
screen for, depression and suicide symptoms routinely in
clinical practice and to look for ... found a 3.4%
attempted suicide rate amongst patients referred from
Kenyatta National General Medical facilities to a psychi-
atric clinic within the same hospital. To date, no s...
Báo cáo y học: "γ Activating and inhibitory Fcγ receptors in rheumatoid arthritis: from treatment to targeted therapies" potx
... Page 2 of 2
(page number not for citation purposes)
Arthritis Research & Therapy Vol 9 No 4 van Roon
antirheumatic therapies in RA patients on FcγR balance,
either peripherally or locally, ... RA synovial
tissue [1]. By enhancing the capacity of effector T cells to
activate B cells as well as fibroblasts and osteoclasts (and
macrophages and dendritic cells), FcγRs thus efficientl...
Báo cáo y học: "Chondroitin and glucosamine sulfate in combination decrease the pro-resorptive properties of human osteoarthritis subchondral bone osteoblasts: a basic science study" pptx
... 5'-GTT-
TACTTTGGTGCCAGG (antisense) and 5'-
GCTTGAAACATAGGAGCTG (sense) (OPG), 5'-GGGTAT-
GAGAACTTGGGATT (antisense) and 5'-CACTATTAAT-
GCCACCGAC (sense) (RANKL), and 5'-
CAGAACATCATCCCTGCCTCT ... [7].
Glucosamine is an aminosaccharide that acts as a preferred
substrate for the biosynthesis of glycosaminoglycan (GAG
chains and, subsequently, for the p...
Từ khóa:
- báo cáo y học
- báo cáo y học cổ truyền
- mẫu báo cáo y học cổ truyền
- bao cao y hoc colchicin
- phan ban luan trong bao cao y hoc co truyen
- tài liệu báo cáo khoa học bản chất của khủng hoảng kinh tế thế giới pdf
- therapy clinical events and the need for a new approach
- 5 cultivating intuition and trusting faith letting go of the need for certainty
- báo cáo khoa học y học