Báo cáo y học: "Specifying and reporting complex behaviour change interventions: the need for a scientific method" potx

... terminology that limits meta-analyses and contributions to science. For example, 'behavioural counselling', 'academic detailing', and 'outreach' can mean very different ... a detailed manual was available), only a few investigators actually measured the presence or strength of the interven- tion in practice, and fewer still included such measures...

Ngày tải lên: 11/08/2014, 05:21

... in the intervention, and 3) the causal processes tar- geted by these change techniques; all in as much detail as is possible, unless these details are already readily availa- ble (e.g., in a prior ... Having consistent terminol- ogy and sufficient information for replication appears to be more problematic for behavioural and organisational interventions than for pharmacolo...

Ngày tải lên: 11/08/2014, 16:20

... pro- vides an antioxidant defense in humans against oxidant- and radical-caused aging and cancer: a hypothesis. Proc Natl Acad Sci U S A 1981, 78:6858-6862. 51. Sanchez-Lozada LG, Tapia E, Bautista-Garcia ... colleagues [10], by Baker and colleagues [11], and by Edwards [12]. Serum urate and vascular effects in laboratory and animal studies Using a rat animal model in which...

Ngày tải lên: 09/08/2014, 14:22

... Australia. Aust N Z J Psychiatry 2004, 38:520-525. 31. Buckley NA, Dawson AH, Whyte IM, Hazell P, Meza A, Britt H: An analysis of age and gender influences on the relative risk for suicide and ... suicide and psy- chiatric consultation: risk factors and suicide mortality dur- ing a five-year follow-up. Acta Psychiatr Scand 1991, 84:545-549. 27. Hawton K, Fagg J: Suicide, and...

Ngày tải lên: 11/08/2014, 17:20

... Tsunami in Thailand and Indonesia [27,43], the Chi-Chi earthquake in Taiwan [16,39] and the Gujarat earthquake in India [44]. As demonstrated, the army plays an important part in the early response ... evacuated mainly by air. It was the air force’s responsibility, along with the air transport organization, to provide the evacuation by air. In addition they carried managers,...

Ngày tải lên: 25/10/2012, 09:56

... immediately immersedinliquidnitrogen. Nucleic acid isolation and analysis For Northern analyses, 20 lg total RNA were separated on 1.2% formaldehyde–agarose gels and then capillary trans- ferred to a Hybond-N + membrane (Amersham Pharmacia Biotech) ... within a closely related AKR family. Sequences aligned are DpAR1 and DpAR2, D. purpurea (this study); AAC23647, AAD32792, CAB88350...

Ngày tải lên: 18/03/2014, 01:20

... diacylglycerols from plasma VLDL triacylglycerols. NEU derivatives of diacylglycerols were prepared after partial deacylation of plasma VLDL triacylglycerols and they were separated and analysed ... stereochemical incompatibility. Other hypotheses could be advanced about a preferential release of the saturated and monounsaturated fatty acids for the purposes of oxidation as well...

Ngày tải lên: 23/03/2014, 21:20

... clearly demonstrate the need for appropri- ate practices and policies to increase awareness of, and screen for, depression and suicide symptoms routinely in clinical practice and to look for ... found a 3.4% attempted suicide rate amongst patients referred from Kenyatta National General Medical facilities to a psychi- atric clinic within the same hospital. To date, no s...

Ngày tải lên: 08/08/2014, 23:21

... Page 2 of 2 (page number not for citation purposes) Arthritis Research & Therapy Vol 9 No 4 van Roon antirheumatic therapies in RA patients on FcγR balance, either peripherally or locally, ... RA synovial tissue [1]. By enhancing the capacity of effector T cells to activate B cells as well as fibroblasts and osteoclasts (and macrophages and dendritic cells), FcγRs thus efficientl...

Ngày tải lên: 09/08/2014, 10:20

... 5'-GTT- TACTTTGGTGCCAGG (antisense) and 5'- GCTTGAAACATAGGAGCTG (sense) (OPG), 5'-GGGTAT- GAGAACTTGGGATT (antisense) and 5'-CACTATTAAT- GCCACCGAC (sense) (RANKL), and 5'- CAGAACATCATCCCTGCCTCT ... [7]. Glucosamine is an aminosaccharide that acts as a preferred substrate for the biosynthesis of glycosaminoglycan (GAG chains and, subsequently, for the p...

Ngày tải lên: 09/08/2014, 10:21