Báo cáo y học: "Bilateral temporomandibular joint dislocation in a 29-year-old man: a case report" ppsx

Báo cáo y học: "Bilateral temporomandibular joint dislocation in a 29-year-old man: a case report" ppsx

Báo cáo y học: "Bilateral temporomandibular joint dislocation in a 29-year-old man: a case report" ppsx

... dislocation in a 29-year-old man: a case report Tanujan Thangarajah 1* , Neil Mcculloch 1 , Suthan Thangarajah 2 , Judith Stocker 1 Abstract Introduction: A dislocation of the temporomandibular joint ... Caucasian man with a non-traumatic bilateral anterior temporomandibular joint dislocation. Following several unsuccessful attempts, due to both inadequate patient...

Ngày tải lên: 11/08/2014, 03:21

3 217 0
Báo cáo y học: " Bilateral temporomandibular joint dislocation in a 29-year-old man: a case report" pot

Báo cáo y học: " Bilateral temporomandibular joint dislocation in a 29-year-old man: a case report" pot

... 56:9-13. doi:10.1186/1752-1947-4-263 Cite this article as: Thangarajah et al.: Bilateral temporomandibular joint dislocation in a 29-year-old man: a case report. Journal of Medical Case Reports 2010 4:263. Submit your next manuscript ... dislocation after laryngeal mask airway insertion. Acta Anaesthesiol Taiwan 2008, 46:82-85. 6. Rosemore J, Nikoomanesh P, Lacy BE: Bila...

Ngày tải lên: 11/08/2014, 07:20

3 234 0
Báo cáo y học: "Bilateral sternoclavicular joint septic arthritis secondary to indwelling central venous catheter: a case report" pot

Báo cáo y học: "Bilateral sternoclavicular joint septic arthritis secondary to indwelling central venous catheter: a case report" pot

... intravenous drug abuse. Case presentation: We report a rare case of bilateral sternoclavicular joint septic arthritis in an elderly patient secondary to an indwelling right subclavian vein catheter. ... methicillin-resistant Staphylococcus aureus (MRSA), which was sensitive to vancomycin, gentamicin, rifampicin and tetracyclines, prompting treatment with intravenous vancomycin. A...

Ngày tải lên: 11/08/2014, 23:21

4 267 0
Báo cáo y học: " Recurrent spontaneous hip dislocation in a patient with neurofibromatosis type 1: a case report" potx

Báo cáo y học: " Recurrent spontaneous hip dislocation in a patient with neurofibromatosis type 1: a case report" potx

... neurofibroma in an 18- year-old Caucasian woman following minor trauma. This was originally suggested by the abnormalities on early radiographs of her pelvis and later confirmed with computed tomography ... NF-1. We report a case of recurrent hip dislocation resulting from an intra-articular neurofibroma in an 18-year-old woman. Case report An 18-year-old Caucasian woman with a...

Ngày tải lên: 11/08/2014, 00:23

4 280 0
 Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

Báo cáo y học: " Mutation Analysis of hCDC4 in AML Cells Identifies a New Intronic Polymorphis"

... 2001;413(6853):316-22. 4. Yada M, Hatakeyama S, Kamura T, Nishiyama M, Tsunematsu R, Imaki H, Ishida N, Okumura F, Nakayama K, Nakayama KI. Phosphorylation-dependent degradation of c-Myc is mediated by the F-box ... Tsunematsu R, Nakayama K, Oike Y, Nishiyama M, Ishida N, Hatakeyama S, Bessho Y, Kageyama R, Suda T, Nakayama KI. Mouse Fbw7/Sel-10/Cdc4 is required for notch degradation...

Ngày tải lên: 31/10/2012, 16:49

4 393 0
Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

Báo cáo Y học: Potential active-site residues in polyneuridine aldehyde esterase, a central enzyme of indole alkaloid biosynthesis, by modelling and site-directed mutagenesis ppt

... 5¢-CCGTT TGAGAAGTACAATGAGAAGTGTCCGGCAGATA TG-3¢. C17 0A: 5¢-GGCCCTCAAAATGTTCCAGAATT GCTCAGTCGAGGACCTTG-3¢.C-213S:5¢-CGGTGA AGCGAGCTTATATCTTTTGCAATGAAGATAAAT CATTT-CC-3¢. C25 7A: 5¢GCCAAGGGAAGTTTGCA AGTGCCTGCTTGATATATCAGATT-CA-3¢. ... H24 4A: 5¢-CAAAGAAGCAGATCATAT GGGAATGCTTTCGCAGCCAAGGG-3¢. D21 6A: 5¢-G CGAGCTTATATCTTTTGCAATGAAGATAAATCAT TTCCAGTTGAG-3¢ All of the primers were 5¢-phosphorylate...

Ngày tải lên: 24/03/2014, 04:21

8 345 0
Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps

Báo cáo y học: "ECT associated musical hallucinations in an elderly patient: a case report" pps

... hallu- cinations [2,3]. Musical hallucinations are pseudo hallucinations that originate in memory representations and they may undergo a transition to true hallucination. In musical hal- lucination ... Central Page 1 of 3 (page number not for citation purposes) Annals of General Psychiatry Open Access Case report ECT associated musical hallucinations in an elderly patient: a case...

Ngày tải lên: 08/08/2014, 21:20

3 340 0
Báo cáo y học: "Increased plasma homocysteine levels in patients with multiple sclerosis and depression" ppsx

Báo cáo y học: "Increased plasma homocysteine levels in patients with multiple sclerosis and depression" ppsx

... Z, Jiang X, Gaubatz J, Yang F, Durante W, Chan L, Schafer AI, Pownall HJ, Yang X, Wang H: Hyperhomo- cysteinemia decreases circulating high-density lipoprotein by inhibiting apolipoprotein A- I ... B12 deficiency [7,18,19]. Our results, in agreement with Vrethem et al. [8] and Ramsaransing et al. [9], indicate that Hcy increases may occur in MS in the absence of vitamin B12 and folate...

Ngày tải lên: 08/08/2014, 23:21

5 463 0
Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

Báo cáo y học: "Genome-wide association studies in systemic lupus erythematosus: a perspective" docx

... Chung SA, Ferreira RC, Pant PV, Ballinger DG, Kosoy R, Demirci FY, Kamboh MI, Kao AH, Tian C, Gunnarsson I, Bengtsson AA, Rantapaa-Dahlqvist S, Petri M, Manzi S, Seldin MF, Ronnblom L, Syvanen AC, ... for a much larger additional GWAS, in both Europeans and non-Europeans, with clearly defined clinical criteria and at a much greater density of markers. This scale of experiment, which is...

Ngày tải lên: 09/08/2014, 14:22

2 222 0
Báo cáo y học: "Extra corporal membrane oxygenation in general thoracic surgery: a new single veno-venous cannulatio" potx

Báo cáo y học: "Extra corporal membrane oxygenation in general thoracic surgery: a new single veno-venous cannulatio" potx

... participated in its coordination on the anesthesiologic and extracorporal assistance part. All authors read and approved the final manuscript. Competing interests The authors declare that they have no ... Extracorporeal oxygenation support for curative surgery in a patient with papillary thyroid carcinoma invading the trachea. J Laryngol Otol 2009, 123(7):807-10. 5. Jie Lei, Kai Su, Li...

Ngày tải lên: 10/08/2014, 09:21

3 301 0
w