Báo cáo y học: " Cetirizine a histamine H1 receptor antagonist improves viral myocarditis" pps

Báo cáo y học: " Cetirizine a histamine H1 receptor antagonist improves viral myocarditis" pps

Báo cáo y học: " Cetirizine a histamine H1 receptor antagonist improves viral myocarditis" pps

... 2and 9. TNF -a F, 5′-CATCTTCTCAAAATTCGAGTGACAA; TNF -a R, 5′-TGGGAGTAGACAAGGTACAACCC; TNF -a P, 5′-CACGTCGTAGCAAACCACCAAGTG GA; IL-6F, Based on TaqMan produt No.4331348 IL-6R, Based on TaqMan produt ... Access Cetirizine a histamine H1 receptor antagonist improves viral myocarditis Akira Matsumori * , Kanjo Yamamoto * , Miho Shimada * Abstract Background: We showed that mas...

Ngày tải lên: 11/08/2014, 03:20

6 431 0
Báo cáo y học: "Cetirizine a histamine H1 receptor antagonist improves viral myocarditis" docx

Báo cáo y học: "Cetirizine a histamine H1 receptor antagonist improves viral myocarditis" docx

... viral myocarditis with ribavirin in an animal preparation. Circulation 1985, 71:834-839. 8. Kitaura-Inenaga K, Hara M, Higuchi K, Yamamoto K, Yamaki A, Ono K, Nakano A, Kinoshita M, Sasayama S, ... Access Cetirizine a histamine H1 receptor antagonist improves viral myocarditis Akira Matsumori * , Kanjo Yamamoto * , Miho Shimada * Abstract Background: We showed that mast ce...

Ngày tải lên: 11/08/2014, 06:22

6 126 0
Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps

Báo cáo y học: "Mactinin: a modulator of the monocyte response to inflammation" pps

... http://arthritis-research.com/content/5/6/R310 R315 20. Fujikawa Y, Sabokbar A, Neale S, Athanasou NA: Human osteo- clast formation and bone resorption by monocytes and syn- ovial macrophages in rheumatoid arthritis. Ann Rheum Dis 1996, ... NaCl, pH 7.5, and sequentially treated with affinity-purified rabbit antisera raised against recombinant mactinin, followed by second antibody conjugate...

Ngày tải lên: 09/08/2014, 01:23

7 388 0
Báo cáo y học: "NetPath: a public resource of curated signal transduction pathway" ppsx

Báo cáo y học: "NetPath: a public resource of curated signal transduction pathway" ppsx

... Hariprasad Padhukasahasram 1 , Yashwanth Subbannayya 1 , Renu Goel 1 , Harrys KC Jacob 1,2 , Jun Zhong 2 , Raja Sekhar 1 , Vishalakshi Nanjappa 1 , Lavanya Balakrishnan 1 , Roopashree Subbaiah 1 , ... Keerthikumar S, Mathivanan S, Patankar N, Shafreen B, Renuse S, Pawar H, Ramachandra YL, Prasad TSK, Acharya PK, Ranganathan P, Chaerkady R, Pandey A: Human Proteinpedia: A unified discovery...

Ngày tải lên: 09/08/2014, 20:21

9 398 0
Báo cáo y học: "Production of interleukin-1 receptor antagonist by human articular chondrocyte" ppt

Báo cáo y học: "Production of interleukin-1 receptor antagonist by human articular chondrocyte" ppt

... sIL-1Ra by chondrocytes may have a protective effect against articular inflammatory and catabolic responses. Keywords: cytokines, glucocorticoids, human articular chondrocytes, IL-1 receptor antagonist Received: ... GGCCTCCGCAGTCACCTAATCACTCT C IL-1RN U65590 30,881–30,856 (as) TACTACTCGTCCTCCTGGAAGTAGAA D IL-1RN U65590 26,130–26,109 (as) GGTCGCACTATCCACATCTGGG E β-Actin M10277 1559–1583...

Ngày tải lên: 09/08/2014, 03:24

8 283 0
Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"

Báo cáo y học: "Hypoalbuminaemia – A Marker of Cardiovascular Disease in Patients with Chronic Kidney Disease Stages II - IV"

... cardiovascular disease. In addition, data on food in- take, basal energy expenditure (BEE), and total daily energy expenditure (TEE) were not available for analysis that may have provided a ... demonstrated that hypoalbu- minemia was a strong predictor of mortality in dialysis patients. Kalantar-Zadeh et al (34) also showed higher mortality in dialysis patients with lower albumin. M...

Ngày tải lên: 03/11/2012, 11:52

5 724 0
Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

Báo cáo Y học: Rodent a-chymases are elastase-like proteases pot

... 15, 431–440. 55.Jin,D.,Takai,S.,Yamada,M.,Sakaguchi,M.,Yao ,Y. & Miyazaki, M. (2001) Possible roles of cardiac chymase after myocardial infarction in hamster hearts. Jpn. J. Pharmacol. 86, 203–214. 56. Miyazaki,M.,Wada,T.,Shiota,N.&Takai,S.(1999)Effectofan angiotensin ... Biomedical Research, Hino, Tokyo, Japan; 2 TEIJIN Material Analysis Research Laboratories, Tokyo, Japan; 3 Center f...

Ngày tải lên: 08/03/2014, 09:20

10 382 0
Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

Báo cáo Y học: Importin a binds to an unusual bipartite nuclear localization signal in the heterogeneous ribonucleoprotein type I pptx

... forward primer D11–13 (5¢-ATGGACGGAATCGTCACTGAAGTTGCAGTTA GAGGATCTGACGAACTACTCTCAGGC-3¢)and reverse primer R1 (5¢-ATTGGATCCTTATACACGAGA AGGAGCACC-3¢) to generate the pnPTB-NLD-I D11-13 mutant; ... D11-13 mutant; forward primer F1 (5¢-GGCAGGCATTCAGTC GACATGGACGGAATCGTCACT-3¢) and reverse pri- mer D45-47 (5¢-TACACGAGAAGGAGCACCATCCA TTTTATCTTCTCCTTTACTATCATTACCATTGGCT GT-3¢) to generate the pnPT...

Ngày tải lên: 18/03/2014, 01:20

8 1,1K 0
Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

Báo cáo Y học: Barley a-amylase Met53 situated at the high-affinity subsite )2 belongs to a substrate binding motif in the bfia loop 2 of the catalytic (b/a)8-barrel and is critical for activity and substrate specificity pot

... arrow). Y5 1 AMY2 and Y8 2 TAA are in orange. Other binding residues (W9 AMY2 , H92 AMY2 , T94 AMY2 , A9 5 AMY2 , Y1 30 AMY2 , A1 45 AMY2 , F180 AMY2 , K182 AMY2 , W206 AMY2 , S208 AMY2 , Y2 11 AMY2 , ... TAA (in black). The superimpositioning was guided by the catalytic acids (D179 AMY2 , E204 AMY2 , and D289 AMY2 and D206 TAA , E230 TAA , and D297 TAA ). The invariant Y5 1 AMY2 and...

Ngày tải lên: 31/03/2014, 08:20

14 557 0
Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

Báo cáo Y học: LRP130, a protein containing nine pentatricopeptide repeat motifs, interacts with a single-stranded cytosine-rich sequence of mouse hypervariable minisatellite Pc-1 docx

... and 3-methylcholanthrene, detected by a DNA fingerprint assay. Cancer Res. 52, 5788–5793. 12. Kitazawa, T., Kominami, R., Tanaka, R., Wakabayashi, K. & Nagao, M. (1994) 2-Hydroxyamino-1-methyl-6-phenylimidazo- [4,5,-b]pyridine ... Fukuda, Takashi Sugimura, Minako Nagao and Hitoshi Nakagama Biochemistry Division, National Cancer Center Research Institute, Chuo-ku, Tokyo, Japan Recently, w...

Ngày tải lên: 31/03/2014, 23:20

7 305 0
w