báo cáo khoa học: " Epstein Barr Virus-positive large T-cell lymphoma presenting as acute appendicitis 17 years after cadaveric renal transplant: a case report" docx

báo cáo khoa học: " Epstein Barr Virus-positive large T-cell lymphoma presenting as acute appendicitis 17 years after cadaveric renal transplant: a case report" docx

báo cáo khoa học: " Epstein Barr Virus-positive large T-cell lymphoma presenting as acute appendicitis 17 years after cadaveric renal transplant: a case report" docx

... 82:375-381. doi:10.1186 /175 2-1947-5-5 Cite this article as: Ratuapli et al.: Epstein Barr Virus-positive large T-cell lymphoma presenting as acute appendicitis 17 years after cadaveric renal transplant: a case report. ... Access Epstein Barr Virus-positive large T-cell lymphoma presenting as acute appendicitis 17 years after ca...

Ngày tải lên: 11/08/2014, 02:22

8 202 0
Báo cáo khoa học: "Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia" docx

Báo cáo khoa học: "Epstein-Barr virus latent membrane protein-1 (LMP-1) 30-bp deletion and Xho I-loss is associated with type III nasopharyngeal carcinoma in Malaysia" docx

... 29 cases. ¤ Data are only available for 16 out of 29 cases. €Data was only available for 38 out of 39 cases. ∂ The data was only available for 36 out of 39 cases. Ω Data was only available ... cases. § Data was only available for 31 out of 34 cases. ¥ Data was only available for 28 out of 29 cases. ∞ Data was only available for 26 out of 29 cases. Ø Data was only available for 27 ......

Ngày tải lên: 09/08/2014, 07:21

10 356 1
Báo cáo khoa học: "Epstein-Barr Nuclear Antigen 1 modulates replication of oriP-plasmids by impeding replication and transcription fork migration through the family of repeat" ppt

Báo cáo khoa học: "Epstein-Barr Nuclear Antigen 1 modulates replication of oriP-plasmids by impeding replication and transcription fork migration through the family of repeat" ppt

... strand helicase. The hexameric large T-antigen helicase in the SV40 replication fork has approximately the same mass as the hexameric MCM hel- icase present at replication forks that initiate ... firefly luciferase: AGO83: 5' GGAATACTTCGAAATGTCCG AGO84: 5' TCATTAAAACCGGGAGGTAG Control RT-PCR reactions amplifying the glyceraldehyde phosphate dehydrogenase (GAPDH) transcript were...

Ngày tải lên: 12/08/2014, 04:21

15 212 0
Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

Tài liệu Báo cáo khoa học: Treatment of neutral glycosphingolipid lysosomal storage diseases via inhibition of the ABC drug transporter, MDR1 Cyclosporin A can lower serum and liver globotriaosyl ceramide levels in the Fabry mouse model doc

... Sakuraba H, Kotani M, Kase R, Kobayashi K, Takeuchi M, Ogasawara S, Maruyama Y, Nakajima T, Takaoka Y et al. (2002) Production in yeast of alpha-galactosidase A, a lysosomal enzyme applicable ... Fabry disease. Although the efficacy may not, as yet, be as dramatic as ERT, inhibition of MDR1 may prove most beneficial as an adjunct, rather than alternative to ERT. It is clear that the...

Ngày tải lên: 19/02/2014, 07:20

12 432 0
Báo cáo khoa học: "Robot-assisted complete excision of choledochal cyst type I, hepaticojejunostomy and extracorporeal Roux-en-y anastomosis: a case report and review literature" ppsx

Báo cáo khoa học: "Robot-assisted complete excision of choledochal cyst type I, hepaticojejunostomy and extracorporeal Roux-en-y anastomosis: a case report and review literature" ppsx

... choledochal cyst type I, hepaticojejunostomy and extracorporeal Roux-en-y anastomosis: a case report and review literature Thawatchai Akaraviputh 1* , Atthaphorn Trakarnsanga 1 , Nutnicha Suksamanapun 2 Abstract For ... this article as: Akaraviputh et al.: Robot-assisted complete excision of choledochal cyst type I, hepaticojejunostomy and extracorporeal Roux-en-y anastomosis: a case...

Ngày tải lên: 09/08/2014, 03:22

4 264 0
Báo cáo khoa học: "Upper abdominal body shape is the risk factor for postoperative pancreatic fistula after splenectomy for advanced gastric cancer: A retrospective study" ppsx

Báo cáo khoa học: "Upper abdominal body shape is the risk factor for postoperative pancreatic fistula after splenectomy for advanced gastric cancer: A retrospective study" ppsx

... Medical Center, Gastroenterological Surgery, Yokohama, Japan and 2 Yokohama City University, Yokohama, Japan Email: Naoto Yamamoto* - naoto-y@urahp.yokohama-cu.ac.jp; Takashi Oshima - ohshimatakashi@yahoo.co.jp; ... u0970047@urahp.yokohama-cu.ac.jp; Yasushi Rino - rino@med.yokohama-cu.ac.jp; Toshio Imada - timada@urahp.yokohama-cu.ac.jp; Chikara Kunisaki - s0714@med.yokohama-cu.ac.jp * Cor...

Ngày tải lên: 09/08/2014, 07:21

7 385 0
báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt

báo cáo khoa học: " RNAi-mediated knockdown of cyclooxygenase2 inhibits the growth, invasion and migration of SaOS2 human osteosarcoma cells: a case control study" ppt

... 5’TCGAGAAAAAAaaTCACATTTGATTGACAGTCCActcttgaTGG ACTGTCAATCAAATGTGATTA3’ LV- COX-2siRNA-3 Oligo1: 5’TaaCCTTCTCTAACCTCTCCTATTtcaagagAATAGGAGAGGTT AGAGAAGGTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaCCTTCTCTAACCTCTCCTATTctcttgaAAT AGGAGAGGTTAGAGAAGGTTA3’ The ... 5’TaaACACAGTGCACTACATACTTAtcaagagTAAGTATGTAGTG CACTGTGTTTTTTTTTC3’ Oligo2: 5’TCGAGAAAAAAaaACACAGTGCACTACATACTTActcttgaTAA GTATGTAGTGCACTGTGTTTA3’...

Ngày tải lên: 10/08/2014, 10:21

9 373 0
báo cáo khoa học: "Uneventful octreotide LAR therapy throughout three pregnancies, with favorable delivery and anthropometric measures for each newborn: a case report" doc

báo cáo khoa học: "Uneventful octreotide LAR therapy throughout three pregnancies, with favorable delivery and anthropometric measures for each newborn: a case report" doc

... flaring acne and hirsutism, facial puf- finess, weight gain and paroxysmal myopathy, and para- noiac thoughts of rape and sexual intimidation. Her physical examination revealed pronounced facial ... their gratitude to Prof Eddy Karnieli for his critical reading of the manuscript and for his remarks, as well as to his administrative assistant, Margalit Levi, who was helpful in editing the...

Ngày tải lên: 10/08/2014, 23:20

5 348 0
báo cáo khoa học: " Surgical treatment of giant mesenteric fibromatosis presenting as a gastrointestinal stromal tumor: a case report" doc

báo cáo khoa học: " Surgical treatment of giant mesenteric fibromatosis presenting as a gastrointestinal stromal tumor: a case report" doc

... Case presentation A 64-year-old Caucasian man was admitted to our hos- pital with a ten- year-history of a mild diffus e abdominal pain associated with anorexia. He reported no noticeable weight ... with variable architecture, mitotic activity and nuclear atypia, and myxoid or hyalinized stroma. Necrosis and hemorrhage can also be seen. By contrast, IAFs are characterized by a spati...

Ngày tải lên: 11/08/2014, 02:21

4 353 0
báo cáo khoa học: " Advantages of cone beam computed tomography (CBCT) in the orthodontic treatment planning of cleidocranial dysplasia patients: a case report" ppsx

báo cáo khoa học: " Advantages of cone beam computed tomography (CBCT) in the orthodontic treatment planning of cleidocranial dysplasia patients: a case report" ppsx

... Dalessandri 1,3* , Laura Laffranchi 1,3 , Ingrid Tonni 3 , Francesca Zotti 3 , Maria Grazia Piancino 2 , Corrado Paganelli 3 , Pietro Bracco 2 Abstract Our aim was to discuss, by presenting a case, the ... 59(6):363-76. 19. Kuroda S, Yanagita T, Kyung HM, Takano-Yamamoto T: Titanium screw anchorage for traction of many impacted teeth in a patient with Cleidocranial dysplasia. Am J Orth...

Ngày tải lên: 11/08/2014, 20:20

9 283 0
w