báo cáo khoa học: " A novel mutation in the calcium-sensing receptor gene in an Irish pedigree showing familial hypocalciuric " doc

báo cáo khoa học: " A novel mutation in the calcium-sensing receptor gene in an Irish pedigree showing familial hypocalciuric " doc

báo cáo khoa học: " A novel mutation in the calcium-sensing receptor gene in an Irish pedigree showing familial hypocalciuric " doc

... manuscript. OdB managed the patients, made the diagnosis, and reviewed the manuscript. All authors read and approved the final manuscript. Competing interests The authors declare that they have ... article as: Elamin and de Buyl: A novel mutation in the calcium-sensing receptor gene in an Irish pedigree showing familial hypocalciuric hypercalcemia: a...

Ngày tải lên: 11/08/2014, 02:22

5 385 0
Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

Tài liệu Báo cáo khoa học: A novel c-N-methylaminobutyrate demethylating oxidase involved in catabolism of the tobacco alkaloid nicotine by Arthrobacter nicotinovorans pAO1 ppt

... o-dianisidine (Sigma) and 10 lgÆmL )1 of MABO. The reaction was initiated by the addition of substrate, and the increase in absorption at 430 nm caused by the oxidation of o-dianisidine was followed ... of tryptophan with serine (W66S), also abolished covalent binding of FAD a nd resulted in an inactive enzyme variant. However, this inactivation was accompanied by a drastic...

Ngày tải lên: 19/02/2014, 16:20

8 648 0
Báo cáo khoa học: "A COMPUTATIONAL MODEL OF THE SYNTAX-PROSODY INTERFACE IN TOKYO JAPANESE" doc

Báo cáo khoa học: "A COMPUTATIONAL MODEL OF THE SYNTAX-PROSODY INTERFACE IN TOKYO JAPANESE" doc

... nominal - adnominal keiko no (Keiko-GEN), g~nki na (healthy) verbal - adverbial waratte (laugh-and), amaku (sweetly) verbal - adnominal warau (that laughs), amakatta (that was sweet) The ... Edinburgh. Haraguchi, Shosuke (1977) The Tone Pattern of Japanese: An Autosegmental Theory of Tonology. Kaitakusha, Tokyo. Kaplan, Ronald and Joan Bresnan (1982) Lexical Functional Gramma...

Ngày tải lên: 09/03/2014, 01:20

8 484 0
Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

Báo cáo khoa học: A novel mechanism of TGFb-induced actin reorganization mediated by Smad proteins and Rho GTPases docx

... CCAGACTAGATGTAGTATTTTTTG hRhoA antisense ATTAGAGCCAGATGCTTAAGTCC GAPDH-F ACCACAGTCCATGCCATCAC GAPDH-R TCCACCACCCTGTTGCTGTA L. Vardouli et al. Rho GTPases ⁄ Smad proteins in TGFb-induced actin ... immuno- blotting using the appropriate antibody. Protein band intensity was quantified using PC-based image analysis (Image Analysis Inc.). The data were then normalized using the ratio of act...

Ngày tải lên: 16/03/2014, 06:20

14 420 0
Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

Báo cáo khoa học: A functional polymorphism at the transcriptional initiation site in b2-glycoprotein I (apolipoprotein H) associated with reduced gene expression and lower plasma levels of b2-glycoprotein I docx

... EMSA data that demonstrate an allele- specific binding of nuclear factors and TFIID to the mutation containing sequence; ) 1A has less affinity than )1C. Our novel data demonstrate that the )1C A mutation ... PCR amplified using a forward primer starting at nucleotide )622 (5¢-CCAAGACATACTAAGAATGG-3¢)andthe same reverse primer ending at nucleotide +74 (5¢-GGCA GAGAAAACTCGAGAAC-3¢...

Ngày tải lên: 31/03/2014, 07:20

9 462 0
báo cáo khoa học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" ppt

báo cáo khoa học: " A systematic review of the use of theory in the design of guideline dissemination and implementation strategies and interpretation of the results of rigorous evaluations" ppt

... physician behaviour in the office setting. CMAJ 1985, 132:1025-1029. 52. Raisch D, Bootman J, Larson L, McGhan W: Improving antiulcer agent prescribing in a health maintenance organization. American ... Reinforcing, and Enabling Constructs in Educational D iagnosis and Eva- luation) [68], diffusion of innovation [69], information overload [70], and social marketing (academic detaili...

Ngày tải lên: 11/08/2014, 16:20

6 429 0
Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

Báo cáo khoa học: "A concurrent approach to the automatic extraction of subsegmental primes and phonological constituents from speech" docx

... containing an element in a minimal combination with others. In the case of a resonance element, say, U, the minimal state of combination corresponds to isolated occurrence in a vowel such as [U], as ... identifiable as being either long or short). the words can be identified uniquely by manner class alone. This is the case for languages such as English, German, Fr...

Ngày tải lên: 31/03/2014, 04:20

5 337 0
Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx

Tài liệu Báo cáo khoa học: Effect of gadolinium on the ryanodine receptor/ sarcoplasmic reticulum calcium release channel of skeletal muscle docx

... Gd 3+ modulates the Ca 2+ release channel ⁄ ryanodine receptor residing in the SR membrane. Gadolinium was applied at differ- ent concentrations in the presence of 18 nm ryanodine and the amount of ryanodine ... pre- activated by ATP and cyclic ADP-ribose (cADPR) on the cis side [13,14]. Tripathy et al. and Herrmann-Frank et al. have found activation of the channel at 100–25...

Ngày tải lên: 19/02/2014, 16:20

8 588 1
Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

Báo cáo khoa học: A novel factor XI missense mutation (Val371Ile) in the activation loop is responsible for a case of mild type II factor XI deficiency doc

... were added to the solution, and the amount of free paranitroaniline released by FXIa was determined by measuring the change in absorbance at 405 nm in a Benchmark II microplate reader (Bio-Rad Laboratories, ... using FXI-deficient plasma as sub- strate (Hemoliance, Salt Lake City, UT). FXI antigen was measured by an ELISA based on a goat anti-human FXI affinity purified IgG as ca...

Ngày tải lên: 23/03/2014, 07:20

11 564 0
Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

Tài liệu Báo cáo khoa học: A novel splice variant of occludin deleted in exon 9 and its role in cell apoptosis and invasion docx

... methylated DNA were: 5¢-AAGTAGGCGGAGTATCGAAC-3¢ (sense) and 5¢-GAAAAAACGCGATCCTACTT-3¢ (antisense). Primers for unmethylated DNA were: 5¢-GAAGTAGGTGGAGT ATTGAAT-3¢ (sense) and 5¢-CAAAAAAACACAATCCT ACTT-3¢ ... to invasiveness in cancer. Cancer Res 61, 3493–3500. 30 Giannelli G, Bergamini C, Fransvea E, Sgarra C & Antonaci S (2005) Laminin-5 with transforming growth factor-beta1 induces e...

Ngày tải lên: 18/02/2014, 18:20

12 613 0
w