báo cáo khoa học: "Haemodynamics and oxygenation improvement induced by high frequency percussive ventilation in a patient with hypoxia following cardiac surgery: a case report" pdf

... percussive ventilation in a patient with hypoxia following cardiac surgery: a case report Alessandro Forti * , Valeria Salandin, Paolo Zanatta, Bruno Persi, Carlo Sorbara Abstract Introduction: High frequency ... Haemodynamics and oxygenation improvement induced by high frequency percussive ventilation in a patient with hypoxia followin...

Ngày tải lên: 11/08/2014, 02:21

... Epstein AE, Dual Chamber and VVI Implantable Defibrillator Trial Investigators: Dual chamber pacing or ventricular backup pacing in patients with an implantable defibrillator: the Dual Chamber and ... electromechanical delay and regional longi- tudinal LV strain. The authors have suggested that any RV pacing sites can negatively affect LV function and that readily available and...

Ngày tải lên: 10/08/2014, 23:20

... report a third case. We propose that INO may decrease the inflammatory response in patients with increased intracranial pressure caused by traumatic brain injury accompanied by acute respiratory ... in head injury. In Intracranial Pressure VIII Edited by: Avezaat CJJ, van Eijndhoven JHM, Maas AIR. Berlin: Springer-Verlag; 1993:540-545. 6. Stocchetti N, Maas AIR, Chieregato A...

Ngày tải lên: 13/08/2014, 23:20

... ribonuclease swapping dimer. Biopoly- mers 73, 689–695. 42 Vitagliano L, Adinolfi S, Riccio A, Sica F, Zagari A & Mazzarella L (1998) Binding of a substrate analog to a domain swapping protein: X-ray ... encourage the further development and use of N-acylsulfonamides and sulfonimides as antagonists of nucleic acid-binding proteins. Database Structural data for the two RNase A...

Ngày tải lên: 14/02/2014, 22:20

... The target mRNA was normalized against actin in the same sample. The PCR primers were as follows: actin forward, 5¢-GA AATCGTGCGTGACATCAAAG-3¢; actin reverse, 5¢-TG TAGTTTCATGGA TGCCACAG-3¢; Akt-1 ... 687 TTTTTCAGTGCAGAA-3¢; aP2 forward, 5¢-AAAGACA GCTCCTCCTCGAAGGTT-3¢; and aP2 reverse, 5¢-TGA CCAAATCCCCATTTACGC-3¢. Standard curves were gen- erated with 10-fold serial dilutions ranging...

Ngày tải lên: 16/02/2014, 09:20

... the antisera r-anti-l (made in rat) and gp-anti-dW4 (produced in guinea pig), two antisera discriminating CHH isomers (gp-anti-pQl made in guinea pig and rb-anti- pQd in rabbit) [38] and an antiserum ... labelled only with gp-anti-pQL and orange somata ( D-CHH cells) corresponding to labelling with gp-anti-pQL and rb-anti-pQD antisera. (D) Enlargement of axon terminals...

Ngày tải lên: 18/02/2014, 11:20

... cellu- lar components that play a role in hair morphogenesis; and finally, the old idea that proximal In might func- tion as an inhibitor of hair initiation. The available data do not permit a clear ... R3. 2 3 4 5 8 2 3 4 5 8 Fz Dsh Fmi Stbm Pk Dgo A B Row4 Row7 32h APF 24h APF Proximal Distal Proximal Distal Apical Basal Apical Basal Equatorial Polar 2 3 4 5 8 2 3 4 5 8 Fig. 2. C...

Ngày tải lên: 20/02/2014, 01:20

... core apparatus, includ- ing CagX, CagY, CagT, CagV and Cagd, as well as other Cag components such as the ATPase CagE, CagF, CagG, CagZ and CagS [16]. In a different study employing a similar approach, ... cagC and cagf reached values analogous to genes important for bacterial survival and homeostasis, such as catalase, urease and NapA; by contrast, the transcript abundance o...

Ngày tải lên: 06/03/2014, 00:21

... Asp142, Glu144 and Asp215 were mutated indi- vidually to asparagine and alanine, Tyr10 and Tyr214 were replaced by Phe, and Ser93 was replaced by alanine. All clones expressing ChiB variants yielded ... Glu144. Inter- estingly, hevamine and several other naturally occurring family 18 chitinases with clearly acidic pH-optima (around 4.2 [20,46]), have asparagine at the position...

Ngày tải lên: 07/03/2014, 14:20

... 5¢- and 3¢-UTR are underlined and the 13 repeats with a consensus of CCAATGATGATCCAAGAAATCCACACTACAG (31 bp) in the 3¢-UTR are numbered and distinguished from each other by alternate highlighting in ... bold and underlined. The four potential poly (A) signals (AATAAA) in the 3¢-UTR and the TATA box in the 5¢-flanking region are boxed. T. Wang et al. Rainbow trout interl...

Ngày tải lên: 07/03/2014, 16:20