báo cáo khoa học: " Post-operative Aspergillus mediastinitis in a man who was immunocompetent: a case report" potx

báo cáo khoa học: " Post-operative Aspergillus mediastinitis in a man who was immunocompetent: a case report" potx

báo cáo khoa học: " Post-operative Aspergillus mediastinitis in a man who was immunocompetent: a case report" potx

... O, Martinot M, Hansman Y, Eisemann B, Christmann D: AcaseofAspergillus mediastinitis after heart transplantation successfully treated with liposomal amphotericin B, caspofungin and voriconazole. ... this article as: Dimopoulos et al.: Post-operative Aspergillus mediastinitis in a man who was immunocompetent: a case report. Journal of Medical Case Reports 2010 4:312....

Ngày tải lên: 11/08/2014, 02:21

4 279 1
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc

... AYRAAYTCRWRBCCYTTCCA RPE6 5a- Fwd NM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACAC RPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAG RPE65c-Fwd NM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACAC RPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAG RPE6 5a ... CCTTTGACATCGCAAGTGGATCA RPE65c GSP-Fwd NM_001113653 TTGAGGTGACAGACAATTGCCT RPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCG RPE6 5a- His-Fwd NM_200751 GCGGCCGCCACCATGCA...

Ngày tải lên: 14/02/2014, 14:20

14 754 0
Tài liệu Báo cáo khoa học: "Some Pragmatic Issues in the Planning of Definite and Indefinite Noun Phrases" potx

Tài liệu Báo cáo khoa học: "Some Pragmatic Issues in the Planning of Definite and Indefinite Noun Phrases" potx

... speaker mad hearer must mutually beiieve that the dead man is Smith, that he was in fact murdered, and that it was a man who killed him. 5.4 Nonshared Concept Activation with No Identification ... particular importance to utterance planning. Planning requires a characterization of actions that describes what their effects are, when they are appli- cable, and what strat...

Ngày tải lên: 21/02/2014, 20:20

6 659 0
Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf

... inventories: A complex network ap- proach. In COLING-08, pages 601–608. J. R. Quinlan. 1993. C4.5: Programs for Machine Learning. Morgan Kaufmann. S. V. Shanmugam. 1972. Dental and alveolar nasals in Dravidian. ... redundancy in the classifica- tory system. This is because, such a distinction is prevalent in many other sounds, some of which are (a) nasals in Tamil (Shanmugam, 197...

Ngày tải lên: 22/02/2014, 02:20

9 703 1
Báo cáo khoa học: Common G102S polymorphism in chitotriosidase differentially affects activity towards 4-methylumbelliferyl substrates potx

Báo cáo khoa học: Common G102S polymorphism in chitotriosidase differentially affects activity towards 4-methylumbelliferyl substrates potx

... oligo-saccharide chitohexaose was measured using a HPLC method as described previously [38]. In- gel enzymatic assay In- gel chitinase activity was determined in a 12% polyacryl- amide gel containing SDS, run in the absence ... b-mer- captoethanol. Renaturing of separated proteins was accomplished by incubating the gel for 16 h at room tem- perature in a casein-containing...

Ngày tải lên: 23/03/2014, 04:20

11 351 0
Báo cáo khoa học: Analysis of the in planta antiviral activity of elderberry ribosome-inactivating proteins potx

Báo cáo khoa học: Analysis of the in planta antiviral activity of elderberry ribosome-inactivating proteins potx

... rRNA N-glycosylase activity. The SNA-IV transformant was included as a negative control. As shown in Fig. 2A, the characteristic Endo fragment was only detected in the SNA-V and SNLRP transformants ... After 40 min incubation at 30 °C, the adenine released was quantified by LC/MS on a Waters Alliance/ZQ apparatus (Waters Corporation, Milford, MA, USA). TMV bioassays Based on the...

Ngày tải lên: 23/03/2014, 12:20

8 398 0
Báo cáo khoa học: D-Amino acids in the brain: the biochemistry of brain serine racemase potx

Báo cáo khoa học: D-Amino acids in the brain: the biochemistry of brain serine racemase potx

... using a human hippocampal cDNA library, a different PDZ domain- containing protein was found to interact with serine racemase, also requiring the C-terminal binding motif [30]. Protein interacting ... purified recombinant serine racemase (unpublished data) although perhaps this might be the case in vivo .In addition, both the rat and cow serine racemases are GluR2 AMPAR GluR2 AMPAR...

Ngày tải lên: 30/03/2014, 04:20

8 402 0
Báo cáo khoa học: Role of Tyr84 in controlling the reactivity of Cys34 of human albumin potx

Báo cáo khoa học: Role of Tyr84 in controlling the reactivity of Cys34 of human albumin potx

... implications. It appears that small local alterations have a substantial effect on the entire domain I, and even on the interface between domains I and II. Our data reveal that not only the He1 resonance ... J, Vita J, Singel D, Valeri R & Loscalzo J (1992) Nitric oxide circulates in mammalian plasma primarily as an S-nitroso adduct of serum albumin. Proc Natl Acad Sci USA 89, 7674–76...

Ngày tải lên: 30/03/2014, 15:20

10 387 0
Báo cáo khoa học: "The normal electroretinogram in adult healthy Shih Tzu dogs using the HMsERG" potx

Báo cáo khoa học: "The normal electroretinogram in adult healthy Shih Tzu dogs using the HMsERG" potx

... with a combination of medetomidine and ketamine. Proparacaine eye drops were also applied as a topical anesthetic. Tropicamide eye drops were applied for mydriasis. After 20 min of dark adaptation, ... electrode was placed approximately midpoint between lateral canthus and ipsilateral ear pinna [8]. The active electrode was positioned on the cornea after topical anesthetic eye d...

Ngày tải lên: 07/08/2014, 23:22

6 210 0
Báo cáo khoa học: "Small cell carcinoma in ulcerative colitis - new treatment option: a case report" docx

Báo cáo khoa học: "Small cell carcinoma in ulcerative colitis - new treatment option: a case report" docx

... histolo- gical type of carcinoma associated with ulcerative colitis is adenocarcinoma [2]. We present a case of primary rectal small cell carcinoma in a patient with a history of ulcerative colitis, ... CM, Haggitt RC, et al: Dysplasia in inflammatory bowel disease: standardized classification with provisional clinical applications. Human pathology 1983, 14(11):931-68. 3. Lakatos...

Ngày tải lên: 09/08/2014, 03:23

5 478 0
w