báo cáo khoa học: " Post-operative Aspergillus mediastinitis in a man who was immunocompetent: a case report" potx
báo cáo khoa học: " Post-operative Aspergillus mediastinitis in a man who was immunocompetent: a case report" potx
... O, Martinot M, Hansman Y, Eisemann B,Christmann D: AcaseofAspergillus mediastinitis after hearttransplantation successfully treated with liposomal amphotericin B,caspofungin and voriconazole. ... this article as: Dimopoulos et al.: Post-operative Aspergillus mediastinitis in a man who was immunocompetent: a case report.Journal of Medical Case Reports 2010 4:312.Submit your next manuscript ... identification an environmental source.This finding argues against an ongoing source of con-tamination and is in line with the absence of new casesof infections with Aspergillus among patients...
- 4
- 279
- 1
Tài liệu Báo cáo khoa học: An alternative isomerohydrolase in the retinal Muller cells of a cone-dominant species doc
... AYRAAYTCRWRBCCYTTCCARPE6 5a- FwdNM_200751 GCGGCCGCCACCATGGTCAGCCGTTTTGAACACRPE6 5a- Rev GATATCTTATGGTTTGTACATCCCATGGAAAGRPE65c-FwdNM_001113653 GCGGCCGCCACCATGGTCAGCCGTCTTGAACACRPE65c-Rev AAGCTTCTAAGGTTTGTAGATGCCGTGGAGRPE6 5a ... CCTTTGACATCGCAAGTGGATCARPE65c GSP-FwdNM_001113653 TTGAGGTGACAGACAATTGCCTRPE65c GSP-Rev TCTTTGACTTCTCAAACTGATCGRPE6 5a- His-FwdNM_200751 GCGGCCGCCACCATGCATCATCACCATCACCATGTCAGCCGTTTTGAACACRPE65c-His-FwdNM_001113653 ... Purification and characterization of a transmembrane domain-deleted form of lecithinretinol acyltransferase. Biochemistry 42, 6090–6098.45 Muniz A, Villazana-Espinoza ET, Thackeray B & TsinAT...
- 14
- 753
- 0
Tài liệu Báo cáo khoa học: "Some Pragmatic Issues in the Planning of Definite and Indefinite Noun Phrases" potx
... speaker mad hearer must mutually beiieve that the dead man is Smith, that he was in fact murdered, and that it was a man who killed him. 5.4 Nonshared Concept Activation with No Identification ... particular importance to utterance planning. Planning requires a characterization of actions that describes what their effects are, when they are appli- cable, and what strategies are available ... illocutionary acts can be defined in terms of the kinds of inferences made, given a semantic analysis of an utterance, facts about mu- tual knowledge, and general principles of rational behavior....
- 6
- 658
- 0
Tài liệu Báo cáo khoa học: "Discovering Global Patterns in Linguistic Networks through Spectral Analysis: A Case Study of the Consonant Inventories" pdf
... inventories: A complex network ap-proach. In COLING-08, pages 601–608.J. R. Quinlan. 1993. C4.5: Programs for MachineLearning. Morgan Kaufmann.S. V. Shanmugam. 1972. Dental and alveolar nasals in Dravidian. ... redundancy in the classifica-tory system. This is because, such a distinctionis prevalent in many other sounds, some of whichare (a) nasals in Tamil (Shanmugam, 1972) andMalayalam (Shanmugam, 1972; ... B and Bindicate that im-plicational universals also play a crucial role in determining linguistic typologies. The two ty-pologies that are predominant in this case con-sist of (a) languages...
- 9
- 703
- 1
Báo cáo khoa học: Common G102S polymorphism in chitotriosidase differentially affects activity towards 4-methylumbelliferyl substrates potx
... oligo-saccharidechitohexaose was measured using a HPLC method asdescribed previously [38]. In- gel enzymatic assay In- gel chitinase activity was determined in a 12% polyacryl-amide gel containing SDS, run in the absence ... b-mer-captoethanol. Renaturing of separated proteins was accomplished by incubating the gel for 16 h at room tem-perature in a casein-containing suspension (2.5 gÆL–1casein,20 mm Tris, 2 mm EDTA, ... reaction amplification of the appropriate fragment(primers: RB203 5¢-GGCAGCTGGCAGAGTAAATCC-3¢and RB204 5¢-CCCAGAAGGAAATTCAGCCC-3¢) andsequencing (Big Dye Terminator sequencing kit, AppliedBiosystems,...
- 11
- 351
- 0
Báo cáo khoa học: Analysis of the in planta antiviral activity of elderberry ribosome-inactivating proteins potx
... rRNA N-glycosylase activity. The SNA-IVtransformant was included as a negative control. As shown in Fig. 2A, the characteristic Endo fragment was onlydetected in the SNA-V and SNLRP transformants ... After40 min incubation at 30 °C, the adenine released was quantified by LC/MS on a Waters Alliance/ZQ apparatus(Waters Corporation, Milford, MA, USA).TMV bioassaysBased on the molecular analysis, ... protection.Ribosome-inactivating proteins (RIPs; EC 3.2.2.22) are a heterogeneous family of structurally and evolutionaryrelated plant proteins sharing a common functional domainthat catalytically removes a...
- 8
- 397
- 0
Báo cáo khoa học: D-Amino acids in the brain: the biochemistry of brain serine racemase potx
... using a humanhippocampal cDNA library, a different PDZ domain-containing protein was found to interact with serineracemase, also requiring the C-terminal binding motif[30]. Protein interacting ... purifiedrecombinant serine racemase (unpublished data)although perhaps this might be the case in vivo .In addition, both the rat and cow serine racemases areGluR2AMPARGluR2AMPARGluR2AMPARGluR2AMPARL-SerD-SerCCCCCL-SerD-SerCCPCPPPABCDL-SerD-SerL-SerD-SerFig. ... dehydratases.Serine racemase was first purified from rat brain homogenates and laterrecombinantly expressed in mammalian and insect cells as well as in Escherichia coli. It has been shown that serine racemase...
- 8
- 402
- 0
Báo cáo khoa học: Role of Tyr84 in controlling the reactivity of Cys34 of human albumin potx
... implications. It appears that small local alterationshave a substantial effect on the entire domain I, andeven on the interface between domains I and II.Our data reveal that not only the He1 resonance ... J,Vita J, Singel D, Valeri R & Loscalzo J (1992) Nitricoxide circulates in mammalian plasma primarily as anS-nitroso adduct of serum albumin. Proc Natl Acad SciUSA 89, 7674–7677.15 Kashiba-Iwatsuki ... nucleotidesequence analysis across the mutation site by the dideoxychain termination sequencing. The mutated cDNA was inserted into a pAYE316 based yeast expression plasmid[34] and Saccharomyces cerevisiae...
- 10
- 387
- 0
Báo cáo khoa học: "The normal electroretinogram in adult healthy Shih Tzu dogs using the HMsERG" potx
... with a combination of medetomidine and ketamine. Proparacaine eye drops were also applied as a topical anesthetic. Tropicamide eye drops were applied for mydriasis. After 20 min of dark adaptation, ... electrode was placed approximately midpoint between lateral canthus and ipsilateral ear pinna [8]. The active electrode was positioned on the cornea after topical anesthetic eye drops (0.5% proparacaine ... equipment in adult Shih Tzu dogs showingnormal vision. Std R&C: standard rod and cone, Hi-int R&C: high-intensity rod and cone.Tabl e 2 . a- and b- wave amplitude and b /a ratio a- wave ampli-...
- 6
- 210
- 0
Báo cáo khoa học: "Small cell carcinoma in ulcerative colitis - new treatment option: a case report" docx
... histolo-gical type of carcinoma associated with ulcerative colitisis adenocarcinoma [2]. We present a case of primaryrectal small cell carcinoma in a patient with a history ofulcerative colitis, ... CM,Haggitt RC, et al: Dysplasia in inflammatory bowel disease: standardizedclassification with provisional clinical applications. Human pathology1983, 14(11):931-68.3. Lakatos PL, Lakatos ... tosome patients at an early stage, when no distant metas-tases are present [13]. In our case the patient had nometastases at the time of presentation, so a radical sur-gery was performed. Intraoperative...
- 5
- 478
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPNghiên cứu vật liệu biến hóa (metamaterials) hấp thụ sóng điện tử ở vùng tần số THzđề thi thử THPTQG 2019 toán THPT chuyên thái bình lần 2 có lời giảiBiện pháp quản lý hoạt động dạy hát xoan trong trường trung học cơ sở huyện lâm thao, phú thọGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitNGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWAN SLIDEPhát triển mạng lưới kinh doanh nước sạch tại công ty TNHH một thành viên kinh doanh nước sạch quảng ninhTrả hồ sơ điều tra bổ sung đối với các tội xâm phạm sở hữu có tính chất chiếm đoạt theo pháp luật Tố tụng hình sự Việt Nam từ thực tiễn thành phố Hồ Chí Minh (Luận văn thạc sĩ)Phát hiện xâm nhập dựa trên thuật toán k meansThiết kế và chế tạo mô hình biến tần (inverter) cho máy điều hòa không khíTranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtTrách nhiệm của người sử dụng lao động đối với lao động nữ theo pháp luật lao động Việt Nam từ thực tiễn các khu công nghiệp tại thành phố Hồ Chí Minh (Luận văn thạc sĩ)BÀI HOÀN CHỈNH TỔNG QUAN VỀ MẠNG XÃ HỘIĐổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namTÁI CHẾ NHỰA VÀ QUẢN LÝ CHẤT THẢI Ở HOA KỲQUẢN LÝ VÀ TÁI CHẾ NHỰA Ở HOA KỲ