báo cáo khoa học: " Highly Active Engineered-Enzyme Oriented Monolayers: Formation, Characterization and Sensing Applications" ppsx
... 76:6116-6121. doi:10.1186/1477-3155-9-26 Cite this article as: Ulman et al.: Highly Active Engineered-Enzyme Oriented Monolayers: Formation, Characterization and Sensing Applications. Journal of Nanobiotechnology 2011 ... designed and developed the AK-based platform, performed SAM covered substrates preparation and characterization and QCM data acquisition and anal...
Ngày tải lên: 11/08/2014, 00:23
... 0.1% TFA in water and 20% of 0.1% TFA in 40% acetonitrile. Excitation and emission wavelengths of the fluorescence detector were set at 450 and 525 nm, respectively. FAD and FMN standards were used ... AAAA CTGCAGTCAATGATGATGATGATGATGGGCCTCG TCCTTCAGCG. MfeI and PstI sites were inserted in for- ward and reverse primers, respectively, upstream and down- stream the start and the...
Ngày tải lên: 19/02/2014, 06:20
... was obtained with 30 V acceleration voltage. Characterization of AThDP and AThTP by 1 H-NMR, 13 C-NMR and 31 P-NMR One-dimensional 1 H-NMR, 13 C-NMR and 31 P-NMR spec- tra were recorded at 25 °C ... assay. Presence of AThDP and AThTP in mouse and quail tissues Mice (Mus musculus, C57BL6 ⁄ 129SvJ mixed genetic back- ground) and quails (Coturnix japonica japonica) were decap- itat...
Ngày tải lên: 07/03/2014, 01:20
Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt
... of SVMPs and ADAMs, and the corresponding portions of ADAMTSs. Despite low amino acid sequence iden- tities (e.g. 15% between VAP and ADAM10, 16% between VAP1 and ADAMTS13 (D), and 17% ... ADAM10 [215] and the D and C A domains of human ADAMTS13 [200] are shown in ribbon representation. The conserved N-terminal a-helix, C-terminal b-strands and disulfide bonds are shown i...
Ngày tải lên: 14/03/2014, 22:20
báo cáo khoa học: " Analysis of trigeminal nerve disorders after oral and maxillofacial intervention" ppsx
... differences between week 4 and week 7, nor between week 7 and week 10. Correlations between QST parameters and age On week 1 and 4, there was a positive correlation between CDT and age (Figure 5). Discussion The ... infraorbital, mental and lingual nerves. The patients were tested 1 week, 4 weeks, 7 weeks and 10 weeks following oral and maxillofacial surgery. Results: QST moni...
Ngày tải lên: 11/08/2014, 20:20
Báo cáo khoa học: Biologically active, non membrane-anchored precursors – an overview ppt
... and gastrin-like peptides, and medi- ates growth factor effects of autocrine and exogenous gastrins on colon cancer and intestinal epithelial cells. Oncogene 26, 425–440. 66 Ferrand A, Bertrand ... mark- ers and chronic heart failure, progastrin is found to be elevated in colorectal cancers and hypergastrinemia, and proGRP is a useful marker for SCLC patients and for prostate...
Ngày tải lên: 07/03/2014, 05:20
Báo cáo khoa học: Functionally active fusion protein of the novel composite cytokine CLC/soluble CNTF receptor pdf
... specificity and IL-12 bioac tivity and demonstrates antitumor activity. J. Immunol. 16 3 , 250–258. 60. Oh,J.W.,VanWagoner,N.J.,Rose-John,S.&Benveniste,E.N. (1998) Role of IL-6 and the soluble ... J. Biochem. 269) 1941 and i n SK-N-GP neuroblastoma cells. In response to CC–FP, CLC/sCNTFR and LIF, a clear induction of tyrosine phosphorylation was detected for gp130 and LIFR (Fig...
Ngày tải lên: 08/03/2014, 10:20
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... active D2 is required for RPTPa to bind to its substrate, Src, and to dephosphorylate and activate it. Materials and methods Materials and antibodies Anti-HA-tag (12CA5), anti-Src (327) Igs and ... 1 lgÆmL )1 of aprotinin and 1 mgÆmL )1 of lysozyme, and incubated for 10 min at room temperature. The suspension was sonicated on ice, A. M. Vacaru and J. den Hertog Active RPTP...
Ngày tải lên: 15/03/2014, 10:20
Báo cáo khoa học: Highly site-selective stability increases by glycosylation of dihydrofolate reductase ppt
... 20 °C and thermal melting curves of WT EcDHFR and DM EcDHFR. Fig. S3. Urea denaturation curves and free energy of unfolding for WT EcDHFR and DM EcDHFR. Fig. S4. Binding curves for NADPH and folate ... support from the UK’s Biotechnology and Biological Sciences Research Council (BBSRC) through grants 6 ⁄ B15285 (SLF, RSS and RKA) and BB ⁄ E008380 ⁄ 1 (RKA and EJL) and from...
Ngày tải lên: 15/03/2014, 11:20
Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx
... for most fish AFPs, and occurred from the prism plane for insect hyperactive AFPs. They ascribed the former observa- tion to no binding ability of fish AFPs to the basal plane and the latter to ... of a minute amount of the fully active antifreeze substance. Materials and methods Sample preparation Recombinant proteins of the type III AFP isoforms nfeAFP6 and nfeAFP8 were prepared as...
Ngày tải lên: 16/03/2014, 04:20