báo cáo khoa học: " Highly Active Engineered-Enzyme Oriented Monolayers: Formation, Characterization and Sensing Applications" ppsx
báo cáo khoa học: " Highly Active Engineered-Enzyme Oriented Monolayers: Formation, Characterization and Sensing Applications" ppsx
... 76:6116-6121.
doi:10.1186/1477-3155-9-26
Cite this article as: Ulman et al.: Highly Active Engineered-Enzyme
Oriented Monolayers: Formation, Characterization and Sensing
Applications. Journal of Nanobiotechnology 2011 ... designed and
developed the AK-based platform, performed SAM covered substrates
preparation and characterization and QCM data acquisition and anal...
Tài liệu Báo cáo khoa học: Agrobacterium tumefaciens type II NADH dehydrogenase Characterization and interactions with bacterial and thylakoid membranes ppt
... 0.1% TFA in water and 20% of 0.1% TFA in
40% acetonitrile. Excitation and emission wavelengths of
the fluorescence detector were set at 450 and 525 nm,
respectively. FAD and FMN standards were used ... AAAA
CTGCAGTCAATGATGATGATGATGATGGGCCTCG
TCCTTCAGCG. MfeI and PstI sites were inserted in for-
ward and reverse primers, respectively, upstream and down-
stream the start and the...
Báo cáo khoa học: Thiaminylated adenine nucleotides Chemical synthesis, structural characterization and natural occurrence potx
... was obtained
with 30 V acceleration voltage.
Characterization of AThDP and AThTP
by
1
H-NMR,
13
C-NMR and
31
P-NMR
One-dimensional
1
H-NMR,
13
C-NMR and
31
P-NMR spec-
tra were recorded at 25 °C ... assay.
Presence of AThDP and AThTP in mouse
and quail tissues
Mice (Mus musculus, C57BL6 ⁄ 129SvJ mixed genetic back-
ground) and quails (Coturnix japonica japonica) were decap-
itat...
Báo cáo khoa học: Enzymatic toxins from snake venom: structural characterization and mechanism of catalysis ppt
... of
SVMPs and ADAMs, and the corresponding portions
of ADAMTSs. Despite low amino acid sequence iden-
tities (e.g. 15% between VAP and ADAM10,
16% between VAP1 and ADAMTS13 (D), and
17% ... ADAM10
[215] and the D and C
A
domains of human ADAMTS13 [200] are
shown in ribbon representation. The conserved N-terminal a-helix,
C-terminal b-strands and disulfide bonds are shown i...
báo cáo khoa học: " Analysis of trigeminal nerve disorders after oral and maxillofacial intervention" ppsx
... differences
between week 4 and week 7, nor between week 7 and
week 10.
Correlations between QST parameters and age
On week 1 and 4, there was a positive correlation
between CDT and age (Figure 5).
Discussion
The ... infraorbital, mental and lingual
nerves. The patients were tested 1 week, 4 weeks, 7 weeks and 10 weeks following oral and maxillofacial surgery.
Results: QST moni...
Báo cáo khoa học: Biologically active, non membrane-anchored precursors – an overview ppt
... and gastrin-like peptides, and medi-
ates growth factor effects of autocrine and exogenous
gastrins on colon cancer and intestinal epithelial cells.
Oncogene 26, 425–440.
66 Ferrand A, Bertrand ... mark-
ers and chronic heart failure, progastrin is found to be
elevated in colorectal cancers and hypergastrinemia,
and proGRP is a useful marker for SCLC patients and
for prostate...
Báo cáo khoa học: Functionally active fusion protein of the novel composite cytokine CLC/soluble CNTF receptor pdf
... specificity
and IL-12 bioac tivity and demonstrates antitumor activity.
J. Immunol. 16 3 , 250–258.
60. Oh,J.W.,VanWagoner,N.J.,Rose-John,S.&Benveniste,E.N.
(1998) Role of IL-6 and the soluble ... J. Biochem. 269) 1941
and i n SK-N-GP neuroblastoma cells. In response to
CC–FP, CLC/sCNTFR and LIF, a clear induction of
tyrosine phosphorylation was detected for gp130 and LIFR
(Fig...
Báo cáo khoa học: Catalytically active membrane-distal phosphatase domain of receptor protein-tyrosine phosphatase a is required for Src activation doc
... active D2 is required for RPTPa to
bind to its substrate, Src, and to dephosphorylate and
activate it.
Materials and methods
Materials and antibodies
Anti-HA-tag (12CA5), anti-Src (327) Igs and ... 1 lgÆmL
)1
of aprotinin
and 1 mgÆmL
)1
of lysozyme, and incubated for 10 min at
room temperature. The suspension was sonicated on ice,
A. M. Vacaru and J. den Hertog Active RPTP...
Báo cáo khoa học: Highly site-selective stability increases by glycosylation of dihydrofolate reductase ppt
... 20 °C and thermal melting
curves of WT EcDHFR and DM EcDHFR.
Fig. S3. Urea denaturation curves and free energy of
unfolding for WT EcDHFR and DM EcDHFR.
Fig. S4. Binding curves for NADPH and folate ... support from the UK’s Biotechnology
and Biological Sciences Research Council (BBSRC)
through grants 6 ⁄ B15285 (SLF, RSS and RKA) and
BB ⁄ E008380 ⁄ 1 (RKA and EJL) and from...
Báo cáo khoa học: Fully active QAE isoform confers thermal hysteresis activity on a defective SP isoform of type III antifreeze protein docx
... for most fish
AFPs, and occurred from the prism plane for insect
hyperactive AFPs. They ascribed the former observa-
tion to no binding ability of fish AFPs to the basal
plane and the latter to ... of a
minute amount of the fully active antifreeze substance.
Materials and methods
Sample preparation
Recombinant proteins of the type III AFP isoforms nfeAFP6
and nfeAFP8 were prepared as...
Từ khóa: