báo cáo khoa học: " Simultaneous detection of Human Immunodeficiency Virus 1 and Hepatitis B virus infections using a dual-label time-resolved fluorometric assay" potx
... Sheikh M Talha 2† , Sathyamangalam Swaminathan 2 , Raija Vainionpää 3 , Tero Soukka 1 < /b> , Navin Khanna 2 , Kim Pettersson 1*< /b> Abstract A highly specific and < /b> novel dual-label time-resolved immunofluorometric ... dual-label time-resolved immunofluorometric assay. (A) A schematic illustration of < /b> the assay for simultaneous < /b> detection < /b> of < /b> H...
Ngày tải lên: 11/08/2014, 00:22
... alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b> alt ="" < /b>
Ngày tải lên: 07/08/2014, 18:21
... in 10< /b> % buff- ered formalin and < /b> embedding in paraffin, blocks of < /b> brain tissue from 4 areas (frontal and < /b> caudal mesencephalon, pons, and < /b> medulla at the obex) were analyzed when avail- able. Hematoxylin-eosin ... 3.7%. H&E and < /b> amyloid staining The H&E staining of < /b> brain stem and < /b> mesencephalon from bovine brain obtained from Korean sl...
Ngày tải lên: 07/08/2014, 14:23
báo cáo khoa học: " High prevalence of HIV infection among homeless and street-involved Aboriginal youth in a Canadian setting" potx
... Hospital, 608 -10< /b> 81 < /b> Burrard Street, Vancouver, BC, V6Z 1Y6, Canada and < /b> 4 Western Aboriginal Harm Reduction Society, 380 East Hastings Street, Vancouver, BC, V 6A 1P4, Canada Email: Brandon DL Marshall ... vaginal and < /b> anal intercourse with all regular and < /b> casual partners [10< /b> ,11< /b> ]. Pearson's chi-square test was used to determine the facto...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo sinh học: " Serum levels of preS antigen (HBpreSAg) in chronic hepatitis B virus infected patients" potx
... China, 3 Department of < /b> Microbiology, University of < /b> Alabama at Birmingham, Birmingham, Alabama, 35294, USA, 4 Department of < /b> Medicine, University of < /b> Alabama at Birmingham, Birmingham, Alabama, ... white bars represent the number of < /b> HBpreSAg negative patients and < /b> the black bars represent that of < /b> HBpreSAg positive patients. Table 1:< /b> Aver...
Ngày tải lên: 18/06/2014, 18:20
Báo cáo y học: " The characteristics of the synonymous codon usage in hepatitis B virus and the effects of host on the virus in codon usage pattern" ppsx
... CAG(Q) 0.92 1.< /b> 49 AAT(N) 1.< /b> 36 0.89 AAC(N) 0.64 1.< /b> 11 < /b> AAA(K) 0.73 0.82 AAG(K) 1.< /b> 27 1.< /b> 18 GAT(D) 1.< /b> 04 0.89 GAC(D) 0.96 1.< /b> 11 < /b> GAA(E) 1.< /b> 23 0. 81 < /b> GAG(E) 0.77 1.< /b> 19 TGT(C) 0.80 ... (cllg1987@yahoo.cn) Wei Yan (yw198 617< /b> mm@yahoo.cn) ISSN 17< /b> 43-422X Article type Research Submiss...
Ngày tải lên: 11/08/2014, 21:22
Báo cáo khoa học: Direct detection of stereospecific soman hydrolysis by wild-type human serum paraoxonase potx
... for all four of < /b> the sub- strates is shown below: T A ¼ A 0 =V maxA Þ 1 < /b> À A= A 0 ÞðK mA =K mA ÞðV maxA =V maxA ÞÞ þ B 0 =V maxB Þ 1 < /b> À A= A 0 ÞðK mA =K mB ÞðV maxB =V maxA ÞÞ þðC 0 =V maxC Þ 1 < /b> À A= A 0 ÞðK mA =K mC ÞðV maxC =V maxA ÞÞ þðD 0 =V maxD Þ 1 < /b> ... À B= B 0 ÞðK mB =K mA ÞðV maxA =V maxB ÞÞ þ B 0 =V maxB Þ 1 < /b> À B= B 0 ÞðK mB =K mB ÞðV maxB =V...
Ngày tải lên: 30/03/2014, 09:20
Tài liệu Báo cáo khoa học: PCR detection of nearly any dengue virus strain using a highly sensitive primer ‘cocktail’ ppt
... 9057 9305 248 1G3P6 Group 3 CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV -1 < /b> 10482 10< /b> 6 61 < /b> 179 1G4P 217< /b> Group 4 ATATGCTGAAACGCGTGAG CATCATGAGACAGAGCGAT DENV-3 10< /b> 4 382 279 1G5P30 Group 5 TTCCAACAAGCAGAACAACAT GCTACAGGCAGCACGGTTT DENV-4 ... CAGACTAGTGGTTAGAGGAGA GGAATGATGCTGTAGAGACA DENV -1 < /b> 92 .1 < /b> ± 0.57 73.6 ± 2. 31 < /b> 1G4P 217< /b> ATATGCT...
Ngày tải lên: 14/02/2014, 19:20
Tài liệu Báo cáo khoa học: Autolytic activity of human calpain 7 is enhanced by ESCRT-III-related protein IST1 through MIT–MIM interaction pptx
... USA). Anti-GFP serum (A6 455) was obtained from Invitrogen ⁄ Molecular Probes (Carlsbad, CA, USA). Rabbit pAb against recombinant human < /b> calpain 7 and < /b> mouse mAb against human < /b> calpain 7 were raised as described ... May 2 010< /b> , revised 21 < /b> July 2 010< /b> , accepted 20 August 2 010< /b> ) doi :10< /b> .11< /b> 11/< /b> j .17< /b> 42-4658.2 010< /b> .07822....
Ngày tải lên: 18/02/2014, 04:20