báo cáo khoa học: " Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy" ppsx

... Feldmann - gfeldma4@jhmi.edu; Sheetal Soni - sheetalsoni@gmail.com; Rajani Ravi - ravira@jhmi.edu; Collins Karikar - ckarika1@jhmi.edu; Amarnath Maitra - maitraan@yahoo.co.in; Anirban Maitra* ... Access Research Polymeric nanoparticle-encapsulated curcumin ("nanocurcumin"): a novel strategy for human cancer therapy Savita Bisht 1 , Georg Feldmann 1 , Sheetal Soni...

Ngày tải lên: 11/08/2014, 00:22

... mammalian ana- logue is designated mTOR [4]. Rapamycin was analyzed for anticancer activity against a panel of human cancer cell lines by the US National Cancer Institute in the 1980s and was ... Europe [16]. Addition- ally, an orally available rapamycin analogue, everolimus, is approved for use as a preventive therapy for transplant rejection in renal and cardiac transplantat...

Ngày tải lên: 10/08/2014, 22:20

... explored for generating novel nanomaterials. In the last decade several VBNPs have been examined for diverse applications such as templates for material synthesis, platforms for polyvalent display, electronic ... as a DNA-containing virus, the CPV capsid interior has natural affinity for viral single-stranded DNA and therefore lacks the capability to retain any of the non- speci...

Ngày tải lên: 11/08/2014, 00:22

... with pre-equilibrated Ni ⁄ nitrilotriacetate ⁄ agarose (Qiagen, Valen- cia, CA, USA), and rocked at 4 °C for 1 h. The lysate ⁄ Ni ⁄ nitrilotriacetate bead mixture was transferred to a poly prep chromatography ... plasma membrane, which is also required for NADPH activation [9,10]. Once NADPH oxidase is activated, it generates H 2 O 2 , which can func- tion to kill intracellular bacteria...

Ngày tải lên: 20/02/2014, 01:20

... extracted, and the target Z I3 1A gene was amplified by PCR with primers 5¢-AAATA TAAAACGCTAGCGTCGACATGGCGC-3¢ and 5¢-AGC GTAAAGGATGGGGAAAG-3¢. The final ratio of target cells was determined by counting ... Izawa K, Matsumura S, Wakamura K, Tanino T, Tanaka T, Ogino C, Fukuda H & Kondo A (2009) A simple and immediate method for simultaneously evaluating expression level and plasmid m...

Ngày tải lên: 05/03/2014, 23:20

... tris(hydroxymethyl)ami- nomethane (ICN Biomolecules, Irvine, CA, USA), zinc sulfate (Caledon Laboratory Chemicals, Georgetown, Canada), ammonium formate buffer (Sigma-Aldrich, Oakville, Canada), ammonium ... ESI mass spectrometer funded by the Canada Research Chair program, Doug Hairsine (Western Ontario) for advice and discussion on operation of the ESI mass spectrometer, and ACD Labs for...

Ngày tải lên: 16/03/2014, 06:20

... Nishikawa, S., Katayama, Y., Kimbara, K. & Fukuda, M. (1998) Cloning of a Sphingomonas paucimobilis SYK-6 gene encoding a novel oxyge- nase that cleaves lignin-related biphenyl and characterization ... 249, 348–352. 13. Masai, E., Katayama, Y., Kawai, S., Nishikawa, S., Yamasaki, M. & Morohoshi, N. (1991) Cloning and sequencing of the gene for a Pseudomonas paucimobilis enzy...

Ngày tải lên: 17/03/2014, 03:20

... is labeled for each particular verb as so-called frames. Addition- ally, semantic roles can also be labeled with one of 13 ARGM adjunct labels, such as ARGM-LOC or ARGM-TMP for additional locational ... parser, and because PropBank was built by la- beling the nodes of a hand-annotated parse tree, per- node accuracy is usually reported in papers such as (Pradhan et al., 2004). Unfortunat...

Ngày tải lên: 17/03/2014, 04:20

... in a Data Category Reg- istry (DCR) such as ISOCat. 4 DCs that are not available in ISOCat may be defined and submit- ted for standardization. The second step results in a so-called Data Category ... Inter- national Conference on Language Resources and Evaluation (LREC), pages 43–47, Valletta, Malta. Susan Windisch Brown, Dmitriy Dligach, and Martha Palmer. 2011. VerbNet Class Assignment...

Ngày tải lên: 17/03/2014, 22:20

... 5¢-AAATGGCAACGAAGTCTTCAC-3¢ and 5¢-CAGTCGGAGCTAGGAAGGAA-3¢. Isolation of plasma membrane, intact chloroplasts, stroma and thylakoids The plasma membrane fraction of Arabidopsis was isolated as ... La Jolla, CA, USA) and the uracil-containing primers nt114 (forward: GGCTTAAUATGGCTATGGCGGAAATGG CAACGA) and nt115 (reverse: GGTTTAAU TAAGGATC CTTAATTAAGCCTCAGCGGGTCGGAGCTAGGAAG GAACTT), where the ....

Ngày tải lên: 30/03/2014, 04:20