Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx
Tài liệu Báo cáo khoa học: Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes docx
... assay carried out with purified recombinant plasmid pADC-8; and lanes 5–14 corres-pond to the assay carried out with DNA samples obtained from transformed parasites after 2 days and 2, 4, 6 and ... 633Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruziepimastigotesMarı´ a P. Serra, Carolina Carrillo, Ne´lida S. Gonza´lez and Israel ... N+; Amersham).Total RNA from parasites, before and after transforma-tion, was obtained using TRIzol LS reagent (Invitrogen,Carlsbad, CA, USA) [29]. Samples containing 20 l goftotal RNA were...
- 10
- 570
- 0
Báo cáo khoa học: Assimilation of excess ammonium into amino acids and nitrogen translocation in Arabidopsis thaliana – roles of glutamate synthases and carbamoylphosphate synthetase in leaves ppt
... TCAAAGAAGTCCTGAAGAGCGGGln11 (At5g37600) F: CCTCTCAGACTCCACTGACAAAR: TTCACTGTCTTCACCAGGAGCGln12 (At1g66200) F: TCTCAGACAACAGTGAAAAGATCAR: TGTCTTGACCAGGAGCTTGACGln13 (At3g17820) F: GCCACCGGGAAAATCATCR: ... AATCGAAAACCCTTTCTTAAGLT (At5g53460) F: TTGGACCTGAGCCAACACTTGR: CATCATCCGTTTTGGTGAGGAcarA (At3g27740) F: TGGTCAGGTGGAGATCAGTGCR: GAGGCTTCAGGGTGGTACTGGcarB (At1g29900) F: AGGAAGACCACATGCTGCTGAR: TCAAAGAAGTCCTGAAGAGCGGGln11 ... The amino acids arethen translocated in the apoplasm and in the phloemvia the plasma membrane-located amino acid trans-porters [10]. Glutamine and asparagine, and to a lesserextent arginine,...
- 16
- 384
- 0
Báo cáo khoa học: " Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter" ppt
... think that the results are due to that many shelter cats have been infected with FHV-1 and they remain subclinical carriers after recovery. At least 80% of infected cats remain latently infected ... (5'-TTCGGCCTTTTGTGTTCC-3') and CalcapR (5'-TTGAGAATTGAACACATCAATAGATC-3') amplify a 673-bp conserved region in the capsid protein gene of FCV. Multiplex RT-PCR/PCR was performed according to a previous ... cats in a shelter or a breeding cattery had a low detection rate of C. felis. These results indicate that the Prevalence of FHV-1, FCV and C. felis in an animal shelter 209clinical signs of...
- 3
- 476
- 0
báo cáo khoa học: " Years of life lost to prison: racial and gender gradients in the United States of America" pps
... popula-tion for Caucasian females. In both males and females,there was a consistently clear gradient with rates for His-panics being intermediate between those of African Amer-icans and Caucasians ... (18.4)SOURCE: AJ Beck, JC Karberg. Prison and Jail Inmates at Midyear 2000, 2001, 2002, 2003, 2004.*Includes Indians, Alaska Natives, Asians, Native Hawaiians, and other Pacific Islanders; totals for Caucasian, ... gender and race.Results: African American males can expect to spend on average 3.09 years in prison or jail overtheir lifetime and Hispanic and Caucasian males can spend on average 1.06 and 0.50...
- 5
- 363
- 0
Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx
... Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series. Journal of Medical Case Reports 2011 ... her hip pain improved. About a month prio r to presenta-tion, she again started having hip pain radiating to theanterior region of the right knee. The pain was worsewhen standing up, walking, and ... history of trauma. She was seenby a physician and was diagnosed with osteoarthritis of the hip after an MRI scan. After taking non-steroidalanti-inflammatory drugs (NSAIDs) for a few weeks, herhip...
- 8
- 293
- 0
Báo cáo khoa học: Effects of cardiomyopathic mutations on the biochemical and biophysical properties of the human a-tropomyosin docx
... SKTM -A6 3V (5¢-GACAAATACTCTGAAGTACTCAAAGATGCCCAG-3¢), SKTM-1R (5¢-CTGGGCATCTTTGAGTACTTCAGAGTATTGTC-3¢), SKTM-K70T (5¢-AAAGATGCACAGGAGACGCTGGAGCTGGCAGAG-3¢), SKTM-2R (5¢- CTCTGCCAGCTCCAGCGTCTCCTGTGCATCTTT-3¢), ... occur atthe g posi tion of t he repeat. T he K70T mutation alsointroduces changes in the surface charge of Tm. All themutant amino acids are involved in interchain and intra-chain interactions ... the inability of E. coli to N -a cetylaterecombinant Tm. Amino and carboxy terminal ends of Tmare critical for p olymerization and b inding to actin. BecauseTm binds cooperatively in a head-to-tail...
- 9
- 603
- 0
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf
... repeats from human tenascinstudied through a sequence frame-shift approachFrancesco Zanuttin, Corrado Guarnaccia, Alessandro Pintar and Sa´ndor PongorInternational Centre for Genetic Engineering ... structureelements. A qualitative analysis of the spectra suggests theabsence of helical structure, and a dominant component of irregular structure in all the peptides. A quantitative analysis of secondary ... by standard stepwise solid-phase procedure on a 0.1-mmol scale. In f3, an Ala residue was inserted instead of Ile at the N-terminus and an extra Ser residue was added atthe C-terminus to avoid...
- 12
- 416
- 0
Báo cáo khoa học: "Isolation of cholesterol-lowering lactic acid bacteria from human intestine for probiotic use" ppsx
... reductase and acyl CoA: cholesterol acyltransferase (ACAT) havebeneficial effects on hypercholesterolemia and arteriosclerosis[12].Some natural microorganisms in human intestine arebeneficial in ... 235-245.7.Fukushima M, Yamada A, Endo T, Nakano M. Effects of a mixture of organisms, Lactobacillus acidophilus orStreptococcus faecalis on delta6-desaturase activity in thelivers of rats fed a fat- and cholesterol-enriched ... acid- and bile salt-tolerance and be antagonistagainst putrefactive bacteria in GIT [4,9]. In this study,Streptococcus, Lactobacillus and Bifidobacteriumfrom human intestine were selected as...
- 5
- 562
- 2
Báo cáo khoa học: " Expression of pituitary adenylate cyclase activating polypeptide and its type I receptor mRNAs in human placenta" doc
... the same areas. Although our data did not elucidate thephysiological role and action mechanism of PACAP in human placenta, the localization of PACAP and its PAC1receptor in the same areas strongly ... determine the existence of PACAP and PAC1 receptor mRNAs in human placenta. Our data showedthe expression of PACAP and PAC1 receptor mRNAs in stroma cells of stem villi and terminal villi. As ... suggest that PACAP mayact as an autoregulator or pararegulator via its PAC1 receptor in stem villi and terminal villi during pregnancy. In conclusion, our findings suggest that PACAP may have animportant...
- 5
- 349
- 0
Từ khóa: báo cáo khoa học mẫubáo cáo khoa học y họcbáo cáo khoa học sinh họcbáo cáo khoa học nông nghiệpbáo cáo khoa học lâm nghiệpNghiên cứu sự biến đổi một số cytokin ở bệnh nhân xơ cứng bì hệ thốngBáo cáo quy trình mua hàng CT CP Công Nghệ NPVNghiên cứu tổ chức pha chế, đánh giá chất lượng thuốc tiêm truyền trong điều kiện dã ngoạiMột số giải pháp nâng cao chất lượng streaming thích ứng video trên nền giao thức HTTPGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitGiáo án Sinh học 11 bài 13: Thực hành phát hiện diệp lục và carôtenôitĐỒ ÁN NGHIÊN CỨU CÔNG NGHỆ KẾT NỐI VÔ TUYẾN CỰ LY XA, CÔNG SUẤT THẤP LPWANNghiên cứu, xây dựng phần mềm smartscan và ứng dụng trong bảo vệ mạng máy tính chuyên dùngNghiên cứu tổng hợp các oxit hỗn hợp kích thƣớc nanomet ce 0 75 zr0 25o2 , ce 0 5 zr0 5o2 và khảo sát hoạt tính quang xúc tác của chúngNghiên cứu khả năng đo năng lượng điện bằng hệ thu thập dữ liệu 16 kênh DEWE 5000Tìm hiểu công cụ đánh giá hệ thống đảm bảo an toàn hệ thống thông tinQuản lý nợ xấu tại Agribank chi nhánh huyện Phù Yên, tỉnh Sơn La (Luận văn thạc sĩ)Tăng trưởng tín dụng hộ sản xuất nông nghiệp tại Ngân hàng Nông nghiệp và Phát triển nông thôn Việt Nam chi nhánh tỉnh Bắc Giang (Luận văn thạc sĩ)Tranh tụng tại phiên tòa hình sự sơ thẩm theo pháp luật tố tụng hình sự Việt Nam từ thực tiễn xét xử của các Tòa án quân sự Quân khu (Luận văn thạc sĩ)Giáo án Sinh học 11 bài 15: Tiêu hóa ở động vậtchuong 1 tong quan quan tri rui roGiáo án Sinh học 11 bài 14: Thực hành phát hiện hô hấp ở thực vậtChiến lược marketing tại ngân hàng Agribank chi nhánh Sài Gòn từ 2013-2015Đổi mới quản lý tài chính trong hoạt động khoa học xã hội trường hợp viện hàn lâm khoa học xã hội việt namHIỆU QUẢ CỦA MÔ HÌNH XỬ LÝ BÙN HOẠT TÍNH BẰNG KIỀM