... assay carried out with purified recombinant plasmid pADC-8; and lanes 5–14 corres- pond to the assay carried out with DNA samples obtained from transformed parasites after 2 days and 2, 4, 6 and ... 633 Modulation of oat arginine decarboxylase gene expression and genome organization in transgenic Trypanosoma cruzi epimastigotes Marı ´ a P. Serra, Carolina Carrillo, Ne ´ lida...
Ngày tải lên: 19/02/2014, 07:20
... TCAAAGAAGTCCTGAAGAGCGG Gln11 (At5g37600) F: CCTCTCAGACTCCACTGACAAA R: TTCACTGTCTTCACCAGGAGC Gln12 (At1g66200) F: TCTCAGACAACAGTGAAAAGATCA R: TGTCTTGACCAGGAGCTTGAC Gln13 (At3g17820) F: GCCACCGGGAAAATCATC R: ... AATCGAAAACCCTTTCTTAA GLT (At5g53460) F: TTGGACCTGAGCCAACACTTG R: CATCATCCGTTTTGGTGAGGA carA (At3g27740) F: TGGTCAGGTGGAGATCAGTGC R: GAGGCTTCAGGGTGGTACTGG carB (At1g29900) F: AGGAAGACCAC...
Ngày tải lên: 30/03/2014, 01:20
Báo cáo khoa học: "Detection of Bartonella species from ticks, mites and small mammals in Korea" pps
...
Ngày tải lên: 07/08/2014, 18:21
Báo cáo khoa học: " Prevalence of feline herpesvirus 1, feline calicivirus and Chlamydophila felis in clinically normal cats at a Korean animal shelter" ppt
... think that the results are due to that many shelter cats have been infected with FHV-1 and they remain subclinical carriers after recovery. At least 80% of infected cats remain latently infected ... (5'-TTCGGCCTTTTGTGTTCC-3') and CalcapR (5'-TTGAGAATTGAACACATCAATAGATC-3') amplify a 673-bp conserved region in the capsid protein gene of FCV. Multiplex R...
Ngày tải lên: 07/08/2014, 20:23
báo cáo khoa học: " Years of life lost to prison: racial and gender gradients in the United States of America" pps
... popula- tion for Caucasian females. In both males and females, there was a consistently clear gradient with rates for His- panics being intermediate between those of African Amer- icans and Caucasians ... (18.4) SOURCE: AJ Beck, JC Karberg. Prison and Jail Inmates at Midyear 2000, 2001, 2002, 2003, 2004. *Includes Indians, Alaska Natives, Asians, Native Hawaiians, and other Pa...
Ngày tải lên: 11/08/2014, 18:20
Báo cáo khoa học: "Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series" docx
... Regeneration of human bones in hip osteonecrosis and human cartilage in knee osteoarthritis with autologous adipose-tissue-derived stem cells: a case series. Journal of Medical Case Reports 2011 ... her hip pain improved. About a month prio r to presenta- tion, she again started having hip pain radiating to the anterior region of the right kn...
Ngày tải lên: 10/08/2014, 23:21
Báo cáo khoa học: Effects of cardiomyopathic mutations on the biochemical and biophysical properties of the human a-tropomyosin docx
... SKTM -A6 3V (5¢-GAC AAATACTCTGA AGTACTCAAAGATGCCCAG-3¢), SK TM-1R (5¢-CTGGGCATCTTTGAGTAC TTCAGAGTA TTGTC-3¢), SKTM-K70T (5¢-AAAGATGC ACAGGAG ACGCTGGAGCTGGCAGAG-3¢), SKTM-2R (5¢- CTCTG CCAGCTCCAGCGTCTCCTG TGCATCTTT-3¢), ... occur at the g posi tion of t he repeat. T he K70T mutation also introduces changes in the surface charge of Tm. All the mutant amino acids are involved in intercha...
Ngày tải lên: 16/03/2014, 18:20
Báo cáo khoa học: Folding of epidermal growth factor-like repeats from human tenascin studied through a sequence frame-shift approach pdf
... repeats from human tenascin studied through a sequence frame-shift approach Francesco Zanuttin, Corrado Guarnaccia, Alessandro Pintar and Sa ´ ndor Pongor International Centre for Genetic Engineering ... structure elements. A qualitative analysis of the spectra suggests the absence of helical structure, and a dominant component of irregular structure in all the peptides....
Ngày tải lên: 23/03/2014, 13:20
Báo cáo khoa học: "Isolation of cholesterol-lowering lactic acid bacteria from human intestine for probiotic use" ppsx
... reductase and acyl CoA: cholesterol acyltransferase (ACAT) have beneficial effects on hypercholesterolemia and arteriosclerosis [12]. Some natural microorganisms in human intestine are beneficial in ... 235-245. 7. Fukushima M, Yamada A, Endo T, Nakano M. Effects of a mixture of organisms, Lactobacillus acidophilus or Streptococcus faecalis on delta6-desaturase activity...
Ngày tải lên: 07/08/2014, 18:20
Báo cáo khoa học: " Expression of pituitary adenylate cyclase activating polypeptide and its type I receptor mRNAs in human placenta" doc
... the same areas. Although our data did not elucidate the physiological role and action mechanism of PACAP in human placenta, the localization of PACAP and its PAC 1 receptor in the same areas strongly ... determine the existence of PACAP and PAC 1 receptor mRNAs in human placenta. Our data showed the expression of PACAP and PAC 1 receptor mRNAs in stroma cells of...
Ngày tải lên: 07/08/2014, 18:21